Mutagenetix > Incidental Mutation

Incidental Mutation 'R6749:Siglecg'

532886

Institutional Source

Beutler Lab

Gene Symbol

Siglecg

Ensembl Gene

ENSMUSG00000030468

Gene Name

sialic acid binding Ig-like lectin G

Synonyms

mSiglec-G, A630096C01Rik

MMRRC Submission

044866-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R6749 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43408204-43418358 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43408979 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 97 (I97V)

Ref Sequence

ENSEMBL: ENSMUSP00000005592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005592]

AlphaFold

Q80ZE3

Predicted Effect

probably benign
Transcript: ENSMUST00000005592
AA Change: I97V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: I97V

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	27	139	5.21e-2	SMART
IG_like	148	232	8.97e0	SMART
IGc2	262	325	3.38e-10	SMART
IGc2	366	427	8.26e-5	SMART
low complexity region	473	480	N/A	INTRINSIC
transmembrane domain	545	564	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	G	11: 120,010,774	V875A	possibly damaging	Het
Arhgef15	A	T	11: 68,954,557	F156L	probably damaging	Het
Bdh2	T	A	3: 135,300,691	S184T	probably damaging	Het
Bmp5	A	T	9: 75,776,093	M1L	probably benign	Het
Cacfd1	T	C	2: 27,018,455	Y134H	probably damaging	Het
Camk1	G	A	6: 113,334,525	P340L	probably benign	Het
Ccdc105	A	C	10: 78,752,838	M46R	possibly damaging	Het
Cdc14a	T	C	3: 116,297,158	H424R	possibly damaging	Het
Cntfr	T	A	4: 41,663,232	T192S	possibly damaging	Het
Erbin	G	T	13: 103,834,377	S910R	probably damaging	Het
Esrp1	A	T	4: 11,357,519	V366E	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fsip2	T	A	2: 82,978,394	S1686T	possibly damaging	Het
Gata5	A	G	2: 180,334,350	L7S	probably damaging	Het
Hgf	T	A	5: 16,613,642		probably null	Het
Ift140	A	G	17: 25,098,916	E1458G	probably damaging	Het
Ift57	G	A	16: 49,760,984	G209R	probably benign	Het
Il12rb2	G	T	6: 67,361,966		probably benign	Het
Krt78	G	A	15: 101,950,923	R280C	probably damaging	Het
Lipc	A	G	9: 70,823,386	I88T	probably damaging	Het
Lrmda	G	T	14: 22,027,276	R27L	probably benign	Het
Lrrc37a	T	G	11: 103,502,097	E834A	probably benign	Het
Mmachc	C	A	4: 116,704,541	R132L	probably damaging	Het
Myo10	T	C	15: 25,714,110	Y88H	probably damaging	Het
Myo5b	G	A	18: 74,701,503	R878Q	possibly damaging	Het
Olfr1392	A	G	11: 49,294,050	H243R	probably damaging	Het
Padi3	T	C	4: 140,795,853	T289A	possibly damaging	Het
Pcdhgb4	G	T	18: 37,721,229	A226S	possibly damaging	Het
Pde4c	T	C	8: 70,746,010	V167A	probably damaging	Het
Pigr	A	G	1: 130,846,548	T422A	probably benign	Het
Pmp2	T	C	3: 10,182,482	Y49C	probably benign	Het
Prpf39	A	G	12: 65,056,274	I441V	possibly damaging	Het
Ptprs	A	G	17: 56,437,884	V284A	probably damaging	Het
Rsad1	T	C	11: 94,543,340	E354G	probably damaging	Het
Sema4b	T	A	7: 80,220,201	D412E	possibly damaging	Het
Slc4a3	C	T	1: 75,554,538	R792*	probably null	Het
Slc6a20a	A	G	9: 123,637,070	C569R	probably damaging	Het
Spata19	T	C	9: 27,397,980	V59A	probably benign	Het
Sult2a3	T	A	7: 14,082,704	Y183F	probably benign	Het
Tedc1	C	T	12: 113,158,082	T194M	probably damaging	Het
Tmem63c	T	A	12: 87,075,665	N412K	probably damaging	Het
Trav5-1	T	C	14: 52,622,945	I69T	possibly damaging	Het
Trim68	T	C	7: 102,678,783	D321G	probably damaging	Het
Ttn	T	C	2: 76,865,256		probably benign	Het
Vars2	A	G	17: 35,666,713	V109A	probably damaging	Het
Vmn2r96	C	T	17: 18,598,090	P643L	probably damaging	Het
Zfpm2	G	T	15: 40,954,708	V146F	possibly damaging	Het
Znfx1	T	C	2: 167,056,599	K135R	probably benign	Het

Other mutations in Siglecg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00528:Siglecg	APN	7	43409057	missense	possibly damaging	0.64
IGL00556:Siglecg	APN	7	43411795	missense	probably benign	0.02
IGL01806:Siglecg	APN	7	43411464	splice site	probably null
IGL01947:Siglecg	APN	7	43408763	missense	probably benign	0.43
IGL02257:Siglecg	APN	7	43411904	missense	probably benign	0.00
IGL02410:Siglecg	APN	7	43408829	missense	probably damaging	0.99
IGL02454:Siglecg	APN	7	43408895	missense	probably benign	0.00
Chamonix	UTSW	7	43409422	missense	possibly damaging	0.91
Dollywood	UTSW	7	43411099	missense	probably damaging	1.00
glowworm	UTSW	7	43408579	missense	probably benign	0.04
Montblanc	UTSW	7	43411386	intron	probably benign
Shenandoah	UTSW	7	43408802	missense	probably damaging	0.99
shenandoah2	UTSW	7	43412017	missense	possibly damaging	0.82
Sherando	UTSW	7	43409057	missense	possibly damaging	0.64
Smokies	UTSW	7	43409279	missense	probably benign	0.02
IGL02988:Siglecg	UTSW	7	43418052	missense	probably damaging	1.00
R0134:Siglecg	UTSW	7	43411171	missense	probably damaging	1.00
R0225:Siglecg	UTSW	7	43411171	missense	probably damaging	1.00
R0480:Siglecg	UTSW	7	43411126	missense	probably benign	0.42
R1538:Siglecg	UTSW	7	43417889	missense	possibly damaging	0.53
R1681:Siglecg	UTSW	7	43408941	missense	probably benign	0.17
R2358:Siglecg	UTSW	7	43409422	missense	possibly damaging	0.91
R4428:Siglecg	UTSW	7	43417926	missense	possibly damaging	0.84
R4429:Siglecg	UTSW	7	43417926	missense	possibly damaging	0.84
R4736:Siglecg	UTSW	7	43417908	missense	probably benign	0.03
R4754:Siglecg	UTSW	7	43411871	intron	probably benign
R5017:Siglecg	UTSW	7	43411386	intron	probably benign
R5713:Siglecg	UTSW	7	43408802	missense	probably damaging	0.99
R5777:Siglecg	UTSW	7	43409413	missense	possibly damaging	0.80
R5892:Siglecg	UTSW	7	43412204	intron	probably benign
R6153:Siglecg	UTSW	7	43412017	missense	possibly damaging	0.82
R6154:Siglecg	UTSW	7	43412017	missense	possibly damaging	0.82
R6331:Siglecg	UTSW	7	43408754	missense	possibly damaging	0.83
R6562:Siglecg	UTSW	7	43409057	missense	possibly damaging	0.64
R7066:Siglecg	UTSW	7	43411742	missense	probably benign	0.40
R7884:Siglecg	UTSW	7	43409279	missense	probably benign	0.02
R8275:Siglecg	UTSW	7	43412468	missense	probably benign
R8554:Siglecg	UTSW	7	43408896	missense	probably benign	0.01
R8846:Siglecg	UTSW	7	43412518	missense	probably benign	0.02
R8873:Siglecg	UTSW	7	43418024	missense	probably benign	0.00
R8887:Siglecg	UTSW	7	43408584	missense	probably benign	0.18
R9012:Siglecg	UTSW	7	43411099	missense	probably damaging	1.00
R9032:Siglecg	UTSW	7	43411625	missense	probably benign	0.24
R9048:Siglecg	UTSW	7	43408579	missense	probably benign	0.04
R9085:Siglecg	UTSW	7	43411625	missense	probably benign	0.24
R9313:Siglecg	UTSW	7	43412432	missense	probably benign	0.03
R9320:Siglecg	UTSW	7	43409429	missense	probably benign	0.33
R9745:Siglecg	UTSW	7	43418052	missense	probably damaging	0.98
RF006:Siglecg	UTSW	7	43408864	nonsense	probably null
Z1177:Siglecg	UTSW	7	43412022	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCTACTTCCTACAGGTGC -3'
(R):5'- CAGTGAGAGACCAAGGTTCC -3'

Sequencing Primer
(F):5'- CTTCCTACAGGTGCAGAGAATTG -3'
(R):5'- AGAGACCAAGGTTCCCTGCTATG -3'

Posted On

2018-08-29