Incidental Mutation 'R6749:Siglecg'
ID532886
Institutional Source Beutler Lab
Gene Symbol Siglecg
Ensembl Gene ENSMUSG00000030468
Gene Namesialic acid binding Ig-like lectin G
SynonymsmSiglec-G, A630096C01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43408204-43418358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43408979 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 97 (I97V)
Ref Sequence ENSEMBL: ENSMUSP00000005592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005592]
Predicted Effect probably benign
Transcript: ENSMUST00000005592
AA Change: I97V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: I97V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 27 139 5.21e-2 SMART
IG_like 148 232 8.97e0 SMART
IGc2 262 325 3.38e-10 SMART
IGc2 366 427 8.26e-5 SMART
low complexity region 473 480 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Siglecg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Siglecg APN 7 43409057 missense possibly damaging 0.64
IGL00556:Siglecg APN 7 43411795 missense probably benign 0.02
IGL01806:Siglecg APN 7 43411464 splice site probably null
IGL01947:Siglecg APN 7 43408763 missense probably benign 0.43
IGL02257:Siglecg APN 7 43411904 missense probably benign 0.00
IGL02410:Siglecg APN 7 43408829 missense probably damaging 0.99
IGL02454:Siglecg APN 7 43408895 missense probably benign 0.00
Chamonix UTSW 7 43409422 missense possibly damaging 0.91
Montblanc UTSW 7 43411386 intron probably benign
Shenandoah UTSW 7 43408802 missense probably damaging 0.99
shenandoah2 UTSW 7 43412017 missense possibly damaging 0.82
Sherando UTSW 7 43409057 missense possibly damaging 0.64
Smokies UTSW 7 43409279 missense probably benign 0.02
IGL02988:Siglecg UTSW 7 43418052 missense probably damaging 1.00
R0134:Siglecg UTSW 7 43411171 missense probably damaging 1.00
R0225:Siglecg UTSW 7 43411171 missense probably damaging 1.00
R0480:Siglecg UTSW 7 43411126 missense probably benign 0.42
R1538:Siglecg UTSW 7 43417889 missense possibly damaging 0.53
R1681:Siglecg UTSW 7 43408941 missense probably benign 0.17
R2358:Siglecg UTSW 7 43409422 missense possibly damaging 0.91
R4428:Siglecg UTSW 7 43417926 missense possibly damaging 0.84
R4429:Siglecg UTSW 7 43417926 missense possibly damaging 0.84
R4736:Siglecg UTSW 7 43417908 missense probably benign 0.03
R4754:Siglecg UTSW 7 43411871 intron probably benign
R5017:Siglecg UTSW 7 43411386 intron probably benign
R5713:Siglecg UTSW 7 43408802 missense probably damaging 0.99
R5777:Siglecg UTSW 7 43409413 missense possibly damaging 0.80
R5892:Siglecg UTSW 7 43412204 intron probably benign
R6153:Siglecg UTSW 7 43412017 missense possibly damaging 0.82
R6154:Siglecg UTSW 7 43412017 missense possibly damaging 0.82
R6331:Siglecg UTSW 7 43408754 missense possibly damaging 0.83
R6562:Siglecg UTSW 7 43409057 missense possibly damaging 0.64
R7066:Siglecg UTSW 7 43411742 missense probably benign 0.40
R7884:Siglecg UTSW 7 43409279 missense probably benign 0.02
R8275:Siglecg UTSW 7 43412468 missense probably benign
RF006:Siglecg UTSW 7 43408864 nonsense probably null
Z1177:Siglecg UTSW 7 43412022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTACTTCCTACAGGTGC -3'
(R):5'- CAGTGAGAGACCAAGGTTCC -3'

Sequencing Primer
(F):5'- CTTCCTACAGGTGCAGAGAATTG -3'
(R):5'- AGAGACCAAGGTTCCCTGCTATG -3'
Posted On2018-08-29