Incidental Mutation 'R6749:Sema4b'
ID532888
Institutional Source Beutler Lab
Gene Symbol Sema4b
Ensembl Gene ENSMUSG00000030539
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
SynonymsSemac, SemC
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R6749 (G1)
Quality Score136.008
Status Validated
Chromosome7
Chromosomal Location80186841-80226527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80220201 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 412 (D412E)
Ref Sequence ENSEMBL: ENSMUSP00000145622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032754] [ENSMUST00000205822]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032754
AA Change: D412E

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032754
Gene: ENSMUSG00000030539
AA Change: D412E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Sema 57 494 8.07e-177 SMART
PSI 512 582 4.7e-9 SMART
low complexity region 626 639 N/A INTRINSIC
transmembrane domain 701 723 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205822
AA Change: D412E

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal cerebellar morphology. Mice homozygous for a knock-out allele exhibit enhanced memory response by way of increased IgE and IgG1 serum levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Sema4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Sema4b APN 7 80215696 missense probably damaging 1.00
IGL02584:Sema4b APN 7 80224988 missense probably benign
IGL02657:Sema4b APN 7 80217041 missense probably damaging 1.00
false_flag UTSW 7 80198654 start codon destroyed probably null
R0114:Sema4b UTSW 7 80219078 splice site probably benign
R0480:Sema4b UTSW 7 80220206 missense probably damaging 1.00
R1184:Sema4b UTSW 7 80224640 missense probably benign 0.27
R1545:Sema4b UTSW 7 80219023 missense probably benign 0.02
R1687:Sema4b UTSW 7 80219262 missense probably damaging 1.00
R1880:Sema4b UTSW 7 80216792 missense probably damaging 0.96
R1881:Sema4b UTSW 7 80216792 missense probably damaging 0.96
R2180:Sema4b UTSW 7 80212835 missense probably benign 0.28
R2352:Sema4b UTSW 7 80220879 missense probably damaging 0.99
R2424:Sema4b UTSW 7 80219275 missense probably damaging 1.00
R3913:Sema4b UTSW 7 80220474 missense probably benign
R4353:Sema4b UTSW 7 80215651 missense probably damaging 1.00
R4757:Sema4b UTSW 7 80216829 missense probably damaging 1.00
R4921:Sema4b UTSW 7 80198756 missense possibly damaging 0.77
R5004:Sema4b UTSW 7 80216345 missense probably benign 0.13
R5399:Sema4b UTSW 7 80224886 missense probably benign
R5599:Sema4b UTSW 7 80213291 missense probably benign 0.40
R5820:Sema4b UTSW 7 80224958 missense probably damaging 0.99
R5840:Sema4b UTSW 7 80218949 missense probably damaging 1.00
R5901:Sema4b UTSW 7 80224967 missense possibly damaging 0.49
R6600:Sema4b UTSW 7 80212928 missense probably benign 0.42
R6992:Sema4b UTSW 7 80220152 missense probably damaging 0.97
R7175:Sema4b UTSW 7 80198654 start codon destroyed probably null
R7660:Sema4b UTSW 7 80220247 missense probably benign 0.01
R8345:Sema4b UTSW 7 80220819 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGCCTTTGGACCAGCACAG -3'
(R):5'- CTACCAGCCATGCATGTATTG -3'

Sequencing Primer
(F):5'- GAAAGGCAGATGTTCCATGATTTCTG -3'
(R):5'- GCATGTATTGCCCTCCTTAAC -3'
Posted On2018-08-29