Incidental Mutation 'R6749:Trim68'
ID532889
Institutional Source Beutler Lab
Gene Symbol Trim68
Ensembl Gene ENSMUSG00000073968
Gene Nametripartite motif-containing 68
SynonymsRnf137, F730114J12Rik, SS-56
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102677582-102687327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102678783 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 321 (D321G)
Ref Sequence ENSEMBL: ENSMUSP00000080813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082175] [ENSMUST00000210855]
Predicted Effect probably damaging
Transcript: ENSMUST00000082175
AA Change: D321G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080813
Gene: ENSMUSG00000073968
AA Change: D321G

DomainStartEndE-ValueType
RING 16 60 1.61e-8 SMART
BBOX 93 134 9.89e-9 SMART
coiled coil region 187 226 N/A INTRINSIC
PRY 302 354 1.91e-24 SMART
SPRY 355 482 3.03e-28 SMART
Predicted Effect silent
Transcript: ENSMUST00000210855
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif-containing protein family, whose members are characterized by a "really interesting new gene" (RING) finger domain, a zinc-binding B-box motif, and a coiled-coil region. Members of this family function as E3 ubiquitin ligases and are involved in a broad range of biological processes. This gene regulates the activation of nuclear receptors, such as androgen receptor, and has been implicated in development of prostate cancer cells, where its expression increases in response to a downregulation of microRNAs. In addition, this gene participates in viral defense regulation as a negative regulator of interferon-beta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Trim68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Trim68 APN 7 102679141 splice site probably null
IGL02703:Trim68 APN 7 102684079 missense probably damaging 0.99
IGL02835:Trim68 UTSW 7 102678573 missense probably benign 0.21
R1765:Trim68 UTSW 7 102680390 missense possibly damaging 0.82
R1780:Trim68 UTSW 7 102684073 missense possibly damaging 0.58
R4107:Trim68 UTSW 7 102678451 missense probably benign 0.01
R4451:Trim68 UTSW 7 102684473 start codon destroyed probably damaging 1.00
R5385:Trim68 UTSW 7 102678783 missense probably damaging 1.00
R5793:Trim68 UTSW 7 102684353 missense possibly damaging 0.74
R5980:Trim68 UTSW 7 102678831 missense probably damaging 1.00
R6912:Trim68 UTSW 7 102684468 missense probably damaging 1.00
R7396:Trim68 UTSW 7 102678362 nonsense probably null
R7789:Trim68 UTSW 7 102684469 missense possibly damaging 0.61
R7892:Trim68 UTSW 7 102678797 missense unknown
R8096:Trim68 UTSW 7 102678442 missense probably damaging 1.00
X0067:Trim68 UTSW 7 102684132 missense probably benign 0.00
Z1176:Trim68 UTSW 7 102678813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGATAAGTACACCACCTCC -3'
(R):5'- AATGGCTCAGTGCAATCTGG -3'

Sequencing Primer
(F):5'- GATAAGTACACCACCTCCTTCCGG -3'
(R):5'- CAGTGCAATCTGGATGCTTCATCTAG -3'
Posted On2018-08-29