Incidental Mutation 'R6749:Pde4c'
ID532890
Institutional Source Beutler Lab
Gene Symbol Pde4c
Ensembl Gene ENSMUSG00000031842
Gene Namephosphodiesterase 4C, cAMP specific
SynonymsE130301F19Rik, dunce, Dpde1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6749 (G1)
Quality Score199.009
Status Validated
Chromosome8
Chromosomal Location70723720-70751186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70746010 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 167 (V167A)
Ref Sequence ENSEMBL: ENSMUSP00000119312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034307] [ENSMUST00000110095] [ENSMUST00000123739] [ENSMUST00000224874]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034307
AA Change: V167A

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034307
Gene: ENSMUSG00000031842
AA Change: V167A

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
HDc 386 512 1.48e0 SMART
Pfam:PDEase_I 526 598 5.3e-21 PFAM
low complexity region 625 636 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110095
AA Change: V167A

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105722
Gene: ENSMUSG00000031842
AA Change: V167A

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
HDc 386 561 5.11e-6 SMART
low complexity region 659 670 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123739
AA Change: V167A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119312
Gene: ENSMUSG00000031842
AA Change: V167A

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224874
AA Change: V127A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.2116 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Pde4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01938:Pde4c APN 8 70749378 missense probably damaging 1.00
IGL02052:Pde4c APN 8 70748413 missense probably damaging 0.99
IGL02484:Pde4c APN 8 70748052 splice site probably benign
IGL02567:Pde4c APN 8 70747921 missense probably benign 0.11
IGL03355:Pde4c APN 8 70746595 missense probably damaging 1.00
coffee UTSW 8 70745329 missense probably damaging 0.99
tea UTSW 8 70748972 missense possibly damaging 0.67
R0396:Pde4c UTSW 8 70750076 missense probably benign
R1103:Pde4c UTSW 8 70748417 missense probably damaging 1.00
R1161:Pde4c UTSW 8 70749923 missense possibly damaging 0.90
R1310:Pde4c UTSW 8 70749923 missense possibly damaging 0.90
R1420:Pde4c UTSW 8 70748417 missense probably damaging 1.00
R1456:Pde4c UTSW 8 70746613 missense probably benign 0.42
R1586:Pde4c UTSW 8 70746859 missense probably damaging 1.00
R1817:Pde4c UTSW 8 70726989 missense probably benign
R1818:Pde4c UTSW 8 70726989 missense probably benign
R1843:Pde4c UTSW 8 70747950 missense probably damaging 1.00
R1984:Pde4c UTSW 8 70724542 missense probably damaging 1.00
R2001:Pde4c UTSW 8 70747358 unclassified probably null
R2088:Pde4c UTSW 8 70749356 missense possibly damaging 0.88
R4334:Pde4c UTSW 8 70749826 splice site probably null
R5369:Pde4c UTSW 8 70750105 makesense probably null
R5521:Pde4c UTSW 8 70747382 critical splice donor site probably null
R6168:Pde4c UTSW 8 70750039 missense probably benign 0.01
R7197:Pde4c UTSW 8 70745329 missense probably damaging 0.99
R7426:Pde4c UTSW 8 70748972 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CCTCAGTGATGGTCTTGTCCTG -3'
(R):5'- CAGAGGACTTTCACAGCTGC -3'

Sequencing Primer
(F):5'- ATGGTCTTGTCCTGCAGAC -3'
(R):5'- ATACCTGTTGGGGCTGCC -3'
Posted On2018-08-29