Mutagenetix > Incidental Mutation

Incidental Mutation 'R6749:Lipc'

532892

Institutional Source

Beutler Lab

Gene Symbol

Lipc

Ensembl Gene

ENSMUSG00000032207

Gene Name

lipase, hepatic

Synonyms

Hpl, HL

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R6749 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70798128-70952226 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70823386 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 88 (I88T)

Ref Sequence

ENSEMBL: ENSMUSP00000149638 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034731] [ENSMUST00000214995] [ENSMUST00000216798]

AlphaFold

P27656

Predicted Effect

probably benign
Transcript: ENSMUST00000034731
AA Change: I88T

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000034731
Gene: ENSMUSG00000032207
AA Change: I88T

Domain	Start	End	E-Value	Type
Pfam:Lipase	14	350	1.1e-136	PFAM
LH2	353	488	4.62e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000214995
AA Change: I88T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably benign
Transcript: ENSMUST00000216798
AA Change: I3T

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

Meta Mutation Damage Score

0.6672

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIPC encodes hepatic triglyceride lipase, which is expressed in liver. LIPC has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit elevated plasma total cholesterol, phospholipids, and high density lipoprotein cholesterol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	G	11: 120,010,774	V875A	possibly damaging	Het
Arhgef15	A	T	11: 68,954,557	F156L	probably damaging	Het
Bdh2	T	A	3: 135,300,691	S184T	probably damaging	Het
Bmp5	A	T	9: 75,776,093	M1L	probably benign	Het
Cacfd1	T	C	2: 27,018,455	Y134H	probably damaging	Het
Camk1	G	A	6: 113,334,525	P340L	probably benign	Het
Ccdc105	A	C	10: 78,752,838	M46R	possibly damaging	Het
Cdc14a	T	C	3: 116,297,158	H424R	possibly damaging	Het
Cntfr	T	A	4: 41,663,232	T192S	possibly damaging	Het
Erbin	G	T	13: 103,834,377	S910R	probably damaging	Het
Esrp1	A	T	4: 11,357,519	V366E	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fsip2	T	A	2: 82,978,394	S1686T	possibly damaging	Het
Gata5	A	G	2: 180,334,350	L7S	probably damaging	Het
Hgf	T	A	5: 16,613,642		probably null	Het
Ift140	A	G	17: 25,098,916	E1458G	probably damaging	Het
Ift57	G	A	16: 49,760,984	G209R	probably benign	Het
Il12rb2	G	T	6: 67,361,966		probably benign	Het
Krt78	G	A	15: 101,950,923	R280C	probably damaging	Het
Lrmda	G	T	14: 22,027,276	R27L	probably benign	Het
Lrrc37a	T	G	11: 103,502,097	E834A	probably benign	Het
Mmachc	C	A	4: 116,704,541	R132L	probably damaging	Het
Myo10	T	C	15: 25,714,110	Y88H	probably damaging	Het
Myo5b	G	A	18: 74,701,503	R878Q	possibly damaging	Het
Olfr1392	A	G	11: 49,294,050	H243R	probably damaging	Het
Padi3	T	C	4: 140,795,853	T289A	possibly damaging	Het
Pcdhgb4	G	T	18: 37,721,229	A226S	possibly damaging	Het
Pde4c	T	C	8: 70,746,010	V167A	probably damaging	Het
Pigr	A	G	1: 130,846,548	T422A	probably benign	Het
Pmp2	T	C	3: 10,182,482	Y49C	probably benign	Het
Prpf39	A	G	12: 65,056,274	I441V	possibly damaging	Het
Ptprs	A	G	17: 56,437,884	V284A	probably damaging	Het
Rsad1	T	C	11: 94,543,340	E354G	probably damaging	Het
Sema4b	T	A	7: 80,220,201	D412E	possibly damaging	Het
Siglecg	A	G	7: 43,408,979	I97V	probably benign	Het
Slc4a3	C	T	1: 75,554,538	R792*	probably null	Het
Slc6a20a	A	G	9: 123,637,070	C569R	probably damaging	Het
Spata19	T	C	9: 27,397,980	V59A	probably benign	Het
Sult2a3	T	A	7: 14,082,704	Y183F	probably benign	Het
Tedc1	C	T	12: 113,158,082	T194M	probably damaging	Het
Tmem63c	T	A	12: 87,075,665	N412K	probably damaging	Het
Trav5-1	T	C	14: 52,622,945	I69T	possibly damaging	Het
Trim68	T	C	7: 102,678,783	D321G	probably damaging	Het
Ttn	T	C	2: 76,865,256		probably benign	Het
Vars2	A	G	17: 35,666,713	V109A	probably damaging	Het
Vmn2r96	C	T	17: 18,598,090	P643L	probably damaging	Het
Zfpm2	G	T	15: 40,954,708	V146F	possibly damaging	Het
Znfx1	T	C	2: 167,056,599	K135R	probably benign	Het

Other mutations in Lipc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lipc	APN	9	70820437	missense	possibly damaging	0.56
IGL02431:Lipc	APN	9	70934468	intron	probably benign
Immunobolic	UTSW	9	70823386	missense	probably damaging	1.00
R0112:Lipc	UTSW	9	70820427	missense	probably damaging	1.00
R0114:Lipc	UTSW	9	70803781	missense	probably damaging	0.99
R0545:Lipc	UTSW	9	70812705	missense	probably damaging	1.00
R1051:Lipc	UTSW	9	70802116	missense	probably benign	0.00
R1069:Lipc	UTSW	9	70823537	missense	probably benign	0.03
R1350:Lipc	UTSW	9	70798367	missense	probably benign	0.00
R1742:Lipc	UTSW	9	70820529	missense	probably damaging	1.00
R2145:Lipc	UTSW	9	70934535	missense	possibly damaging	0.94
R3880:Lipc	UTSW	9	70820518	missense	probably damaging	0.99
R4360:Lipc	UTSW	9	70852582	intron	probably benign
R4999:Lipc	UTSW	9	70816731	missense	probably benign	0.00
R5159:Lipc	UTSW	9	70812910	missense	probably benign	0.03
R5197:Lipc	UTSW	9	70798391	missense	probably benign	0.11
R5458:Lipc	UTSW	9	70852582	intron	probably benign
R5710:Lipc	UTSW	9	70812697	missense	probably benign	0.30
R6645:Lipc	UTSW	9	70803748	missense	probably damaging	1.00
R6849:Lipc	UTSW	9	70818847	critical splice donor site	probably null
R7011:Lipc	UTSW	9	70818954	missense	probably benign	0.09
R7346:Lipc	UTSW	9	70812747	missense	probably damaging	1.00
R7426:Lipc	UTSW	9	70802168	missense	probably benign	0.21
R7587:Lipc	UTSW	9	70818924	missense	probably damaging	1.00
R7830:Lipc	UTSW	9	70812901	missense	probably damaging	1.00
R8269:Lipc	UTSW	9	70820373	missense	probably damaging	1.00
R9087:Lipc	UTSW	9	70802108	missense	probably benign	0.06
R9297:Lipc	UTSW	9	70820454	missense	probably damaging	0.99
R9431:Lipc	UTSW	9	70816607	missense	probably damaging	1.00
R9517:Lipc	UTSW	9	70802278	missense	probably benign	0.00
R9528:Lipc	UTSW	9	70934559	start codon destroyed	probably null	0.98
R9547:Lipc	UTSW	9	70820864	missense	unknown
X0054:Lipc	UTSW	9	70812748	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGAGCTTGATCCTTAGAACC -3'
(R):5'- GAGAAGCCTTGGAGCTACTG -3'

Sequencing Primer
(F):5'- TTACCTGTAACTCCAGATCCAGGG -3'
(R):5'- ATGAAAACGATCGCCTGG -3'

Posted On

2018-08-29