Incidental Mutation 'R6749:Lipc'
ID 532892
Institutional Source Beutler Lab
Gene Symbol Lipc
Ensembl Gene ENSMUSG00000032207
Gene Name lipase, hepatic
Synonyms HL, Hpl
MMRRC Submission 044866-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R6749 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 70705410-70859503 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70730668 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 88 (I88T)
Ref Sequence ENSEMBL: ENSMUSP00000149638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034731] [ENSMUST00000214995] [ENSMUST00000216798]
AlphaFold P27656
Predicted Effect probably benign
Transcript: ENSMUST00000034731
AA Change: I88T

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034731
Gene: ENSMUSG00000032207
AA Change: I88T

DomainStartEndE-ValueType
Pfam:Lipase 14 350 1.1e-136 PFAM
LH2 353 488 4.62e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000214995
AA Change: I88T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000216798
AA Change: I3T

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.6672 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIPC encodes hepatic triglyceride lipase, which is expressed in liver. LIPC has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit elevated plasma total cholesterol, phospholipids, and high density lipoprotein cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 119,901,600 (GRCm39) V875A possibly damaging Het
Arhgef15 A T 11: 68,845,383 (GRCm39) F156L probably damaging Het
Bdh2 T A 3: 135,006,452 (GRCm39) S184T probably damaging Het
Bmp5 A T 9: 75,683,375 (GRCm39) M1L probably benign Het
Cacfd1 T C 2: 26,908,467 (GRCm39) Y134H probably damaging Het
Camk1 G A 6: 113,311,486 (GRCm39) P340L probably benign Het
Cdc14a T C 3: 116,090,807 (GRCm39) H424R possibly damaging Het
Cntfr T A 4: 41,663,232 (GRCm39) T192S possibly damaging Het
Erbin G T 13: 103,970,885 (GRCm39) S910R probably damaging Het
Esrp1 A T 4: 11,357,519 (GRCm39) V366E probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fsip2 T A 2: 82,808,738 (GRCm39) S1686T possibly damaging Het
Gata5 A G 2: 179,976,143 (GRCm39) L7S probably damaging Het
Hgf T A 5: 16,818,640 (GRCm39) probably null Het
Ift140 A G 17: 25,317,890 (GRCm39) E1458G probably damaging Het
Ift57 G A 16: 49,581,347 (GRCm39) G209R probably benign Het
Il12rb2 G T 6: 67,338,950 (GRCm39) probably benign Het
Krt78 G A 15: 101,859,358 (GRCm39) R280C probably damaging Het
Lrmda G T 14: 22,077,344 (GRCm39) R27L probably benign Het
Lrrc37a T G 11: 103,392,923 (GRCm39) E834A probably benign Het
Mmachc C A 4: 116,561,738 (GRCm39) R132L probably damaging Het
Myo10 T C 15: 25,714,196 (GRCm39) Y88H probably damaging Het
Myo5b G A 18: 74,834,574 (GRCm39) R878Q possibly damaging Het
Or2y1f A G 11: 49,184,877 (GRCm39) H243R probably damaging Het
Padi3 T C 4: 140,523,164 (GRCm39) T289A possibly damaging Het
Pcdhgb4 G T 18: 37,854,282 (GRCm39) A226S possibly damaging Het
Pde4c T C 8: 71,198,659 (GRCm39) V167A probably damaging Het
Pigr A G 1: 130,774,285 (GRCm39) T422A probably benign Het
Pmp2 T C 3: 10,247,542 (GRCm39) Y49C probably benign Het
Prpf39 A G 12: 65,103,048 (GRCm39) I441V possibly damaging Het
Ptprs A G 17: 56,744,884 (GRCm39) V284A probably damaging Het
Rsad1 T C 11: 94,434,166 (GRCm39) E354G probably damaging Het
Sema4b T A 7: 79,869,949 (GRCm39) D412E possibly damaging Het
Siglecg A G 7: 43,058,403 (GRCm39) I97V probably benign Het
Slc4a3 C T 1: 75,531,182 (GRCm39) R792* probably null Het
Slc6a20a A G 9: 123,466,135 (GRCm39) C569R probably damaging Het
Spata19 T C 9: 27,309,276 (GRCm39) V59A probably benign Het
Sult2a3 T A 7: 13,816,629 (GRCm39) Y183F probably benign Het
Tedc1 C T 12: 113,121,702 (GRCm39) T194M probably damaging Het
Tektl1 A C 10: 78,588,672 (GRCm39) M46R possibly damaging Het
Tmem63c T A 12: 87,122,439 (GRCm39) N412K probably damaging Het
Trav5-1 T C 14: 52,860,402 (GRCm39) I69T possibly damaging Het
Trim68 T C 7: 102,327,990 (GRCm39) D321G probably damaging Het
Ttn T C 2: 76,695,600 (GRCm39) probably benign Het
Vars2 A G 17: 35,977,605 (GRCm39) V109A probably damaging Het
Vmn2r96 C T 17: 18,818,352 (GRCm39) P643L probably damaging Het
Zfpm2 G T 15: 40,818,104 (GRCm39) V146F possibly damaging Het
Znfx1 T C 2: 166,898,519 (GRCm39) K135R probably benign Het
Other mutations in Lipc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lipc APN 9 70,727,719 (GRCm39) missense possibly damaging 0.56
IGL02431:Lipc APN 9 70,841,750 (GRCm39) intron probably benign
Immunobolic UTSW 9 70,730,668 (GRCm39) missense probably damaging 1.00
R0112:Lipc UTSW 9 70,727,709 (GRCm39) missense probably damaging 1.00
R0114:Lipc UTSW 9 70,711,063 (GRCm39) missense probably damaging 0.99
R0545:Lipc UTSW 9 70,719,987 (GRCm39) missense probably damaging 1.00
R1051:Lipc UTSW 9 70,709,398 (GRCm39) missense probably benign 0.00
R1069:Lipc UTSW 9 70,730,819 (GRCm39) missense probably benign 0.03
R1350:Lipc UTSW 9 70,705,649 (GRCm39) missense probably benign 0.00
R1742:Lipc UTSW 9 70,727,811 (GRCm39) missense probably damaging 1.00
R2145:Lipc UTSW 9 70,841,817 (GRCm39) missense possibly damaging 0.94
R3880:Lipc UTSW 9 70,727,800 (GRCm39) missense probably damaging 0.99
R4360:Lipc UTSW 9 70,759,864 (GRCm39) intron probably benign
R4999:Lipc UTSW 9 70,724,013 (GRCm39) missense probably benign 0.00
R5159:Lipc UTSW 9 70,720,192 (GRCm39) missense probably benign 0.03
R5197:Lipc UTSW 9 70,705,673 (GRCm39) missense probably benign 0.11
R5458:Lipc UTSW 9 70,759,864 (GRCm39) intron probably benign
R5710:Lipc UTSW 9 70,719,979 (GRCm39) missense probably benign 0.30
R6645:Lipc UTSW 9 70,711,030 (GRCm39) missense probably damaging 1.00
R6849:Lipc UTSW 9 70,726,129 (GRCm39) critical splice donor site probably null
R7011:Lipc UTSW 9 70,726,236 (GRCm39) missense probably benign 0.09
R7346:Lipc UTSW 9 70,720,029 (GRCm39) missense probably damaging 1.00
R7426:Lipc UTSW 9 70,709,450 (GRCm39) missense probably benign 0.21
R7587:Lipc UTSW 9 70,726,206 (GRCm39) missense probably damaging 1.00
R7830:Lipc UTSW 9 70,720,183 (GRCm39) missense probably damaging 1.00
R8269:Lipc UTSW 9 70,727,655 (GRCm39) missense probably damaging 1.00
R9087:Lipc UTSW 9 70,709,390 (GRCm39) missense probably benign 0.06
R9297:Lipc UTSW 9 70,727,736 (GRCm39) missense probably damaging 0.99
R9431:Lipc UTSW 9 70,723,889 (GRCm39) missense probably damaging 1.00
R9517:Lipc UTSW 9 70,709,560 (GRCm39) missense probably benign 0.00
R9528:Lipc UTSW 9 70,841,841 (GRCm39) start codon destroyed probably null 0.98
R9547:Lipc UTSW 9 70,728,146 (GRCm39) missense unknown
X0054:Lipc UTSW 9 70,720,030 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGAGCTTGATCCTTAGAACC -3'
(R):5'- GAGAAGCCTTGGAGCTACTG -3'

Sequencing Primer
(F):5'- TTACCTGTAACTCCAGATCCAGGG -3'
(R):5'- ATGAAAACGATCGCCTGG -3'
Posted On 2018-08-29