Incidental Mutation 'R6749:Olfr1392'
ID532896
Institutional Source Beutler Lab
Gene Symbol Olfr1392
Ensembl Gene ENSMUSG00000101750
Gene Nameolfactory receptor 1392
SynonymsMOR256-25, GA_x6K02T2QP88-6141322-6140387
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location49285282-49295891 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49294050 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 243 (H243R)
Ref Sequence ENSEMBL: ENSMUSP00000149746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189851] [ENSMUST00000214170] [ENSMUST00000214598] [ENSMUST00000215861] [ENSMUST00000217275]
Predicted Effect probably damaging
Transcript: ENSMUST00000189851
AA Change: H243R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140904
Gene: ENSMUSG00000101750
AA Change: H243R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 222 7.1e-8 PFAM
Pfam:7tm_1 41 289 2.4e-32 PFAM
Pfam:7tm_4 139 282 1.8e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214170
AA Change: H243R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214598
AA Change: H243R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215861
AA Change: H243R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217275
AA Change: H243R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Olfr1392
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Olfr1392 APN 11 49293630 missense possibly damaging 0.55
IGL02530:Olfr1392 APN 11 49293728 missense possibly damaging 0.78
IGL03026:Olfr1392 APN 11 49293458 missense probably damaging 0.99
IGL03106:Olfr1392 APN 11 49294161 missense probably damaging 0.99
R0357:Olfr1392 UTSW 11 49293786 missense probably damaging 0.96
R0396:Olfr1392 UTSW 11 49293338 missense probably benign 0.00
R2281:Olfr1392 UTSW 11 49293632 missense probably benign 0.04
R4319:Olfr1392 UTSW 11 49293676 missense probably damaging 1.00
R4320:Olfr1392 UTSW 11 49293676 missense probably damaging 1.00
R4322:Olfr1392 UTSW 11 49293676 missense probably damaging 1.00
R4323:Olfr1392 UTSW 11 49293676 missense probably damaging 1.00
R5327:Olfr1392 UTSW 11 49293666 missense probably damaging 1.00
R7779:Olfr1392 UTSW 11 49294221 missense probably damaging 1.00
R8122:Olfr1392 UTSW 11 49293574 missense probably damaging 0.99
X0012:Olfr1392 UTSW 11 49293933 missense probably benign 0.36
X0025:Olfr1392 UTSW 11 49293953 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGTGGACATCGACTGAATCAC -3'
(R):5'- TAGTACCTTCCACAGAGCCC -3'

Sequencing Primer
(F):5'- GAATCACTTCTTCTGTGAGATGC -3'
(R):5'- ACAGAGCCCCCTTCATATCTTTG -3'
Posted On2018-08-29