Mutagenetix > Incidental Mutation

Incidental Mutation 'R6749:Arhgef15'

532897

Institutional Source

Beutler Lab

Gene Symbol

Arhgef15

Ensembl Gene

ENSMUSG00000052921

Gene Name

Rho guanine nucleotide exchange factor (GEF) 15

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6749 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68943155-68957480 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 68954557 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 156 (F156L)

Ref Sequence

ENSEMBL: ENSMUSP00000104311 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065040] [ENSMUST00000108671]

AlphaFold

Q5FWH6

Predicted Effect

probably damaging
Transcript: ENSMUST00000065040
AA Change: F156L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000067684
Gene: ENSMUSG00000052921
AA Change: F156L

Domain	Start	End	E-Value	Type
low complexity region	6	36	N/A	INTRINSIC
low complexity region	65	79	N/A	INTRINSIC
low complexity region	84	127	N/A	INTRINSIC
low complexity region	202	221	N/A	INTRINSIC
low complexity region	275	285	N/A	INTRINSIC
low complexity region	335	349	N/A	INTRINSIC
RhoGEF	429	608	1.76e-50	SMART
low complexity region	670	680	N/A	INTRINSIC
Blast:RhoGEF	688	746	1e-22	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000108671
AA Change: F156L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000104311
Gene: ENSMUSG00000052921
AA Change: F156L

Domain	Start	End	E-Value	Type
low complexity region	6	36	N/A	INTRINSIC
low complexity region	65	79	N/A	INTRINSIC
low complexity region	84	127	N/A	INTRINSIC
low complexity region	202	221	N/A	INTRINSIC
low complexity region	275	285	N/A	INTRINSIC
low complexity region	335	349	N/A	INTRINSIC
RhoGEF	429	608	1.76e-50	SMART
low complexity region	670	680	N/A	INTRINSIC
Blast:RhoGEF	688	746	1e-22	BLAST

Meta Mutation Damage Score

0.0650

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein-coupled receptors. This gene encodes a protein that functions as a specific guanine nucleotide exchange factor for RhoA. It also interacts with ephrin A4 in vascular smooth muscle cells. Two alternatively spliced transcripts variants that encode the same protein have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock out allele exhibit increased excitatory synapse formation. Mice homozygous for a knock-out allele exhibit delayed radial growth, sparse vasculature and empty baselment membrane sleeves in the retina. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	G	11: 120,010,774	V875A	possibly damaging	Het
Bdh2	T	A	3: 135,300,691	S184T	probably damaging	Het
Bmp5	A	T	9: 75,776,093	M1L	probably benign	Het
Cacfd1	T	C	2: 27,018,455	Y134H	probably damaging	Het
Camk1	G	A	6: 113,334,525	P340L	probably benign	Het
Ccdc105	A	C	10: 78,752,838	M46R	possibly damaging	Het
Cdc14a	T	C	3: 116,297,158	H424R	possibly damaging	Het
Cntfr	T	A	4: 41,663,232	T192S	possibly damaging	Het
Erbin	G	T	13: 103,834,377	S910R	probably damaging	Het
Esrp1	A	T	4: 11,357,519	V366E	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fsip2	T	A	2: 82,978,394	S1686T	possibly damaging	Het
Gata5	A	G	2: 180,334,350	L7S	probably damaging	Het
Hgf	T	A	5: 16,613,642		probably null	Het
Ift140	A	G	17: 25,098,916	E1458G	probably damaging	Het
Ift57	G	A	16: 49,760,984	G209R	probably benign	Het
Il12rb2	G	T	6: 67,361,966		probably benign	Het
Krt78	G	A	15: 101,950,923	R280C	probably damaging	Het
Lipc	A	G	9: 70,823,386	I88T	probably damaging	Het
Lrmda	G	T	14: 22,027,276	R27L	probably benign	Het
Lrrc37a	T	G	11: 103,502,097	E834A	probably benign	Het
Mmachc	C	A	4: 116,704,541	R132L	probably damaging	Het
Myo10	T	C	15: 25,714,110	Y88H	probably damaging	Het
Myo5b	G	A	18: 74,701,503	R878Q	possibly damaging	Het
Olfr1392	A	G	11: 49,294,050	H243R	probably damaging	Het
Padi3	T	C	4: 140,795,853	T289A	possibly damaging	Het
Pcdhgb4	G	T	18: 37,721,229	A226S	possibly damaging	Het
Pde4c	T	C	8: 70,746,010	V167A	probably damaging	Het
Pigr	A	G	1: 130,846,548	T422A	probably benign	Het
Pmp2	T	C	3: 10,182,482	Y49C	probably benign	Het
Prpf39	A	G	12: 65,056,274	I441V	possibly damaging	Het
Ptprs	A	G	17: 56,437,884	V284A	probably damaging	Het
Rsad1	T	C	11: 94,543,340	E354G	probably damaging	Het
Sema4b	T	A	7: 80,220,201	D412E	possibly damaging	Het
Siglecg	A	G	7: 43,408,979	I97V	probably benign	Het
Slc4a3	C	T	1: 75,554,538	R792*	probably null	Het
Slc6a20a	A	G	9: 123,637,070	C569R	probably damaging	Het
Spata19	T	C	9: 27,397,980	V59A	probably benign	Het
Sult2a3	T	A	7: 14,082,704	Y183F	probably benign	Het
Tedc1	C	T	12: 113,158,082	T194M	probably damaging	Het
Tmem63c	T	A	12: 87,075,665	N412K	probably damaging	Het
Trav5-1	T	C	14: 52,622,945	I69T	possibly damaging	Het
Trim68	T	C	7: 102,678,783	D321G	probably damaging	Het
Ttn	T	C	2: 76,865,256		probably benign	Het
Vars2	A	G	17: 35,666,713	V109A	probably damaging	Het
Vmn2r96	C	T	17: 18,598,090	P643L	probably damaging	Het
Zfpm2	G	T	15: 40,954,708	V146F	possibly damaging	Het
Znfx1	T	C	2: 167,056,599	K135R	probably benign	Het

Other mutations in Arhgef15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00929:Arhgef15	APN	11	68954102	missense	probably damaging	1.00
IGL02382:Arhgef15	APN	11	68954030	missense	probably damaging	0.98
R0041:Arhgef15	UTSW	11	68954516	missense	possibly damaging	0.92
R0208:Arhgef15	UTSW	11	68946373	missense	probably benign	0.09
R0276:Arhgef15	UTSW	11	68953472	splice site	probably benign
R0368:Arhgef15	UTSW	11	68954693	missense	probably damaging	0.99
R0706:Arhgef15	UTSW	11	68954576	missense	probably damaging	1.00
R1628:Arhgef15	UTSW	11	68944814	missense	possibly damaging	0.86
R1966:Arhgef15	UTSW	11	68954675	missense	probably damaging	1.00
R2105:Arhgef15	UTSW	11	68947681	splice site	probably null
R2278:Arhgef15	UTSW	11	68951691	missense	probably damaging	1.00
R4667:Arhgef15	UTSW	11	68954561	missense	probably benign	0.00
R4836:Arhgef15	UTSW	11	68949925	intron	probably benign
R4898:Arhgef15	UTSW	11	68951345	missense	probably benign	0.00
R4966:Arhgef15	UTSW	11	68947317	missense	probably benign	0.08
R5304:Arhgef15	UTSW	11	68947237	missense	probably null	0.32
R5333:Arhgef15	UTSW	11	68947196	intron	probably benign
R5546:Arhgef15	UTSW	11	68954051	missense	probably benign	0.01
R5632:Arhgef15	UTSW	11	68954051	missense	probably benign	0.01
R5707:Arhgef15	UTSW	11	68954715	missense	probably damaging	0.98
R5839:Arhgef15	UTSW	11	68954156	missense	probably benign	0.00
R5926:Arhgef15	UTSW	11	68951955	missense	possibly damaging	0.76
R6376:Arhgef15	UTSW	11	68954970	missense	unknown
R6429:Arhgef15	UTSW	11	68947796	missense	probably damaging	1.00
R6526:Arhgef15	UTSW	11	68949994	missense	probably damaging	1.00
R7460:Arhgef15	UTSW	11	68947035	missense	probably damaging	1.00
R7529:Arhgef15	UTSW	11	68954022	missense	probably damaging	1.00
R7598:Arhgef15	UTSW	11	68946410	missense	probably damaging	1.00
R7767:Arhgef15	UTSW	11	68953847	missense	probably damaging	0.99
R7919:Arhgef15	UTSW	11	68947605	missense	probably benign	0.00
R8488:Arhgef15	UTSW	11	68947670	critical splice acceptor site	probably null
R8818:Arhgef15	UTSW	11	68951112	missense	probably damaging	0.99
R9415:Arhgef15	UTSW	11	68951407	missense	probably damaging	1.00
R9663:Arhgef15	UTSW	11	68954429	missense	probably damaging	1.00
X0067:Arhgef15	UTSW	11	68944830	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAAGCTATGTTGAGGTCACCCC -3'
(R):5'- AGCCTGGACTCTCAGACTTC -3'

Sequencing Primer
(F):5'- TTGAGGTCACCCCGCTGC -3'
(R):5'- GGACTCTCAGACTTCCCCTGAC -3'

Posted On

2018-08-29