Incidental Mutation 'R6749:Arhgef15'
ID532897
Institutional Source Beutler Lab
Gene Symbol Arhgef15
Ensembl Gene ENSMUSG00000052921
Gene NameRho guanine nucleotide exchange factor (GEF) 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location68943155-68957480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68954557 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 156 (F156L)
Ref Sequence ENSEMBL: ENSMUSP00000104311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065040] [ENSMUST00000108671]
Predicted Effect probably damaging
Transcript: ENSMUST00000065040
AA Change: F156L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067684
Gene: ENSMUSG00000052921
AA Change: F156L

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
RhoGEF 429 608 1.76e-50 SMART
low complexity region 670 680 N/A INTRINSIC
Blast:RhoGEF 688 746 1e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108671
AA Change: F156L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104311
Gene: ENSMUSG00000052921
AA Change: F156L

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
RhoGEF 429 608 1.76e-50 SMART
low complexity region 670 680 N/A INTRINSIC
Blast:RhoGEF 688 746 1e-22 BLAST
Meta Mutation Damage Score 0.0650 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein-coupled receptors. This gene encodes a protein that functions as a specific guanine nucleotide exchange factor for RhoA. It also interacts with ephrin A4 in vascular smooth muscle cells. Two alternatively spliced transcripts variants that encode the same protein have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock out allele exhibit increased excitatory synapse formation. Mice homozygous for a knock-out allele exhibit delayed radial growth, sparse vasculature and empty baselment membrane sleeves in the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Arhgef15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Arhgef15 APN 11 68954102 missense probably damaging 1.00
IGL02382:Arhgef15 APN 11 68954030 missense probably damaging 0.98
R0041:Arhgef15 UTSW 11 68954516 missense possibly damaging 0.92
R0208:Arhgef15 UTSW 11 68946373 missense probably benign 0.09
R0276:Arhgef15 UTSW 11 68953472 splice site probably benign
R0368:Arhgef15 UTSW 11 68954693 missense probably damaging 0.99
R0706:Arhgef15 UTSW 11 68954576 missense probably damaging 1.00
R1628:Arhgef15 UTSW 11 68944814 missense possibly damaging 0.86
R1966:Arhgef15 UTSW 11 68954675 missense probably damaging 1.00
R2105:Arhgef15 UTSW 11 68947681 splice site probably null
R2278:Arhgef15 UTSW 11 68951691 missense probably damaging 1.00
R4667:Arhgef15 UTSW 11 68954561 missense probably benign 0.00
R4836:Arhgef15 UTSW 11 68949925 intron probably benign
R4898:Arhgef15 UTSW 11 68951345 missense probably benign 0.00
R4966:Arhgef15 UTSW 11 68947317 missense probably benign 0.08
R5304:Arhgef15 UTSW 11 68947237 missense probably null 0.32
R5333:Arhgef15 UTSW 11 68947196 intron probably benign
R5546:Arhgef15 UTSW 11 68954051 missense probably benign 0.01
R5632:Arhgef15 UTSW 11 68954051 missense probably benign 0.01
R5707:Arhgef15 UTSW 11 68954715 missense probably damaging 0.98
R5839:Arhgef15 UTSW 11 68954156 missense probably benign 0.00
R5926:Arhgef15 UTSW 11 68951955 missense possibly damaging 0.76
R6376:Arhgef15 UTSW 11 68954970 missense unknown
R6429:Arhgef15 UTSW 11 68947796 missense probably damaging 1.00
R6526:Arhgef15 UTSW 11 68949994 missense probably damaging 1.00
R7460:Arhgef15 UTSW 11 68947035 missense probably damaging 1.00
R7529:Arhgef15 UTSW 11 68954022 missense probably damaging 1.00
R7598:Arhgef15 UTSW 11 68946410 missense probably damaging 1.00
R7767:Arhgef15 UTSW 11 68953847 missense probably damaging 0.99
X0067:Arhgef15 UTSW 11 68944830 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGCTATGTTGAGGTCACCCC -3'
(R):5'- AGCCTGGACTCTCAGACTTC -3'

Sequencing Primer
(F):5'- TTGAGGTCACCCCGCTGC -3'
(R):5'- GGACTCTCAGACTTCCCCTGAC -3'
Posted On2018-08-29