Mutagenetix > Incidental Mutation

Incidental Mutation 'R6749:Lrrc37a'

532899

Institutional Source

Beutler Lab

Gene Symbol

Lrrc37a

Ensembl Gene

ENSMUSG00000078632

Gene Name

leucine rich repeat containing 37A

Synonyms

LOC237954

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R6749 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103451955-103504597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 103502097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 834 (E834A)

Ref Sequence

ENSEMBL: ENSMUSP00000121903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000153273]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000153273
AA Change: E834A

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: E834A

Domain	Start	End	E-Value	Type
Pfam:LRRC37	199	269	2.6e-15	PFAM
low complexity region	313	329	N/A	INTRINSIC
Pfam:LRRC37	363	432	4e-18	PFAM
low complexity region	457	467	N/A	INTRINSIC
low complexity region	480	492	N/A	INTRINSIC
Pfam:LRRC37	550	619	2.1e-21	PFAM
Pfam:LRRC37	637	704	2.9e-12	PFAM
Pfam:LRRC37	780	851	2.5e-12	PFAM
Pfam:LRRC37	1078	1148	2.7e-18	PFAM
Pfam:LRRC37	1149	1190	2.1e-7	PFAM
Pfam:LRRC37	1187	1258	2.5e-25	PFAM
Pfam:LRRC37	1255	1300	2.6e-7	PFAM
Pfam:LRRC37	1299	1370	2.4e-27	PFAM
Pfam:LRRC37	1369	1420	2.9e-8	PFAM
Pfam:LRRC37	1419	1488	1.3e-24	PFAM
Pfam:LRRC37	1509	1578	9.2e-21	PFAM
Pfam:LRRC37	1575	1620	1.7e-6	PFAM
Pfam:LRRC37	1619	1686	1.7e-20	PFAM
Pfam:LRRC37	1690	1736	7e-10	PFAM
Pfam:LRRC37	1733	1799	7.5e-17	PFAM
Pfam:LRRC37	1789	1854	5.1e-12	PFAM
Pfam:LRRC37	1850	1921	4.2e-21	PFAM
Pfam:LRRC37	1915	1969	1.1e-9	PFAM
low complexity region	2143	2167	N/A	INTRINSIC
low complexity region	2185	2209	N/A	INTRINSIC
low complexity region	2228	2249	N/A	INTRINSIC
low complexity region	2262	2274	N/A	INTRINSIC
low complexity region	2284	2297	N/A	INTRINSIC
LRR	2419	2438	3.09e1	SMART
LRR	2439	2462	9.96e-1	SMART
LRR	2463	2486	8.24e0	SMART
LRR	2490	2514	3.18e1	SMART
low complexity region	2535	2547	N/A	INTRINSIC
coiled coil region	2712	2735	N/A	INTRINSIC
low complexity region	2861	2871	N/A	INTRINSIC
low complexity region	2937	2950	N/A	INTRINSIC
Pfam:LRRC37AB_C	3063	3209	1.1e-77	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

100% (47/47)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	G	11: 120,010,774	V875A	possibly damaging	Het
Arhgef15	A	T	11: 68,954,557	F156L	probably damaging	Het
Bdh2	T	A	3: 135,300,691	S184T	probably damaging	Het
Bmp5	A	T	9: 75,776,093	M1L	probably benign	Het
Cacfd1	T	C	2: 27,018,455	Y134H	probably damaging	Het
Camk1	G	A	6: 113,334,525	P340L	probably benign	Het
Ccdc105	A	C	10: 78,752,838	M46R	possibly damaging	Het
Cdc14a	T	C	3: 116,297,158	H424R	possibly damaging	Het
Cntfr	T	A	4: 41,663,232	T192S	possibly damaging	Het
Erbin	G	T	13: 103,834,377	S910R	probably damaging	Het
Esrp1	A	T	4: 11,357,519	V366E	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fsip2	T	A	2: 82,978,394	S1686T	possibly damaging	Het
Gata5	A	G	2: 180,334,350	L7S	probably damaging	Het
Hgf	T	A	5: 16,613,642		probably null	Het
Ift140	A	G	17: 25,098,916	E1458G	probably damaging	Het
Ift57	G	A	16: 49,760,984	G209R	probably benign	Het
Il12rb2	G	T	6: 67,361,966		probably benign	Het
Krt78	G	A	15: 101,950,923	R280C	probably damaging	Het
Lipc	A	G	9: 70,823,386	I88T	probably damaging	Het
Lrmda	G	T	14: 22,027,276	R27L	probably benign	Het
Mmachc	C	A	4: 116,704,541	R132L	probably damaging	Het
Myo10	T	C	15: 25,714,110	Y88H	probably damaging	Het
Myo5b	G	A	18: 74,701,503	R878Q	possibly damaging	Het
Olfr1392	A	G	11: 49,294,050	H243R	probably damaging	Het
Padi3	T	C	4: 140,795,853	T289A	possibly damaging	Het
Pcdhgb4	G	T	18: 37,721,229	A226S	possibly damaging	Het
Pde4c	T	C	8: 70,746,010	V167A	probably damaging	Het
Pigr	A	G	1: 130,846,548	T422A	probably benign	Het
Pmp2	T	C	3: 10,182,482	Y49C	probably benign	Het
Prpf39	A	G	12: 65,056,274	I441V	possibly damaging	Het
Ptprs	A	G	17: 56,437,884	V284A	probably damaging	Het
Rsad1	T	C	11: 94,543,340	E354G	probably damaging	Het
Sema4b	T	A	7: 80,220,201	D412E	possibly damaging	Het
Siglecg	A	G	7: 43,408,979	I97V	probably benign	Het
Slc4a3	C	T	1: 75,554,538	R792*	probably null	Het
Slc6a20a	A	G	9: 123,637,070	C569R	probably damaging	Het
Spata19	T	C	9: 27,397,980	V59A	probably benign	Het
Sult2a3	T	A	7: 14,082,704	Y183F	probably benign	Het
Tedc1	C	T	12: 113,158,082	T194M	probably damaging	Het
Tmem63c	T	A	12: 87,075,665	N412K	probably damaging	Het
Trav5-1	T	C	14: 52,622,945	I69T	possibly damaging	Het
Trim68	T	C	7: 102,678,783	D321G	probably damaging	Het
Ttn	T	C	2: 76,865,256		probably benign	Het
Vars2	A	G	17: 35,666,713	V109A	probably damaging	Het
Vmn2r96	C	T	17: 18,598,090	P643L	probably damaging	Het
Zfpm2	G	T	15: 40,954,708	V146F	possibly damaging	Het
Znfx1	T	C	2: 167,056,599	K135R	probably benign	Het

Other mutations in Lrrc37a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Lrrc37a	APN	11	103500351	missense	probably benign	0.09
IGL01339:Lrrc37a	APN	11	103497937	missense	unknown
IGL01352:Lrrc37a	APN	11	103499355	missense	probably benign	0.39
IGL01382:Lrrc37a	APN	11	103498755	missense	probably damaging	0.99
IGL01395:Lrrc37a	APN	11	103503861	missense	probably benign	0.24
IGL01645:Lrrc37a	APN	11	103504264	missense	probably benign	0.01
IGL01925:Lrrc37a	APN	11	103498419	missense	probably benign	0.01
IGL02006:Lrrc37a	APN	11	103456491	missense	probably damaging	1.00
IGL02127:Lrrc37a	APN	11	103504539	missense	probably benign	0.01
IGL02184:Lrrc37a	APN	11	103497609	missense	unknown
IGL02218:Lrrc37a	APN	11	103500381	missense	probably benign	0.03
IGL02436:Lrrc37a	APN	11	103498177	missense	unknown
IGL02487:Lrrc37a	APN	11	103496037	missense	unknown
IGL02597:Lrrc37a	APN	11	103504287	missense	probably benign	0.01
IGL02634:Lrrc37a	APN	11	103499112	missense	probably benign	0.09
IGL02818:Lrrc37a	APN	11	103501306	missense	possibly damaging	0.47
IGL02829:Lrrc37a	APN	11	103491174	missense	unknown
IGL02987:Lrrc37a	APN	11	103500413	missense	probably benign	0.03
IGL03081:Lrrc37a	APN	11	103456595	missense	unknown
IGL03210:Lrrc37a	APN	11	103499505	missense	probably benign	0.29
IGL03239:Lrrc37a	APN	11	103499407	missense	probably benign	0.03
IGL03285:Lrrc37a	APN	11	103497673	missense	unknown
IGL03296:Lrrc37a	APN	11	103497673	missense	unknown
IGL03299:Lrrc37a	APN	11	103497673	missense	unknown
IGL03370:Lrrc37a	APN	11	103497673	missense	unknown
IGL03390:Lrrc37a	APN	11	103496031	missense	unknown
Lark	UTSW	11	103464354	critical splice donor site	probably null
Longspur	UTSW	11	103502314	missense	probably benign	0.42
F5770:Lrrc37a	UTSW	11	103455512	missense	possibly damaging	0.95
P0035:Lrrc37a	UTSW	11	103503132	missense	possibly damaging	0.84
PIT4458001:Lrrc37a	UTSW	11	103504512	missense	probably benign	0.04
R0112:Lrrc37a	UTSW	11	103500913	missense	probably benign	0.19
R0194:Lrrc37a	UTSW	11	103499790	missense	possibly damaging	0.82
R0360:Lrrc37a	UTSW	11	103500640	missense	possibly damaging	0.89
R0364:Lrrc37a	UTSW	11	103500640	missense	possibly damaging	0.89
R0395:Lrrc37a	UTSW	11	103464395	missense	unknown
R0418:Lrrc37a	UTSW	11	103503438	missense	probably benign	0.03
R0505:Lrrc37a	UTSW	11	103503025	missense	probably benign	0.10
R0583:Lrrc37a	UTSW	11	103498437	missense	probably benign	0.01
R1078:Lrrc37a	UTSW	11	103497631	missense	unknown
R1581:Lrrc37a	UTSW	11	103457017	nonsense	probably null
R1888:Lrrc37a	UTSW	11	103498761	missense	probably benign	0.18
R1888:Lrrc37a	UTSW	11	103498761	missense	probably benign	0.18
R1907:Lrrc37a	UTSW	11	103457156	missense	unknown
R1982:Lrrc37a	UTSW	11	103498966	missense	probably benign	0.20
R1991:Lrrc37a	UTSW	11	103500261	missense	probably benign	0.29
R2017:Lrrc37a	UTSW	11	103501125	missense	probably benign	0.03
R2103:Lrrc37a	UTSW	11	103500261	missense	probably benign	0.29
R2110:Lrrc37a	UTSW	11	103497822	missense	unknown
R2190:Lrrc37a	UTSW	11	103500043	missense	possibly damaging	0.82
R2252:Lrrc37a	UTSW	11	103501467	missense	probably benign	0.01
R2253:Lrrc37a	UTSW	11	103501467	missense	probably benign	0.01
R2894:Lrrc37a	UTSW	11	103497864	missense	unknown
R2899:Lrrc37a	UTSW	11	103497864	missense	unknown
R3439:Lrrc37a	UTSW	11	103497864	missense	unknown
R3899:Lrrc37a	UTSW	11	103497546	missense	unknown
R3916:Lrrc37a	UTSW	11	103455518	missense	possibly damaging	0.83
R3921:Lrrc37a	UTSW	11	103501470	missense	probably benign	0.10
R3977:Lrrc37a	UTSW	11	103457604	missense	unknown
R4043:Lrrc37a	UTSW	11	103498653	missense	possibly damaging	0.95
R4077:Lrrc37a	UTSW	11	103497982	missense	unknown
R4237:Lrrc37a	UTSW	11	103502289	missense	probably damaging	0.97
R4461:Lrrc37a	UTSW	11	103464354	critical splice donor site	probably null
R4498:Lrrc37a	UTSW	11	103501798	missense	probably benign	0.20
R4593:Lrrc37a	UTSW	11	103498969	missense	possibly damaging	0.64
R4670:Lrrc37a	UTSW	11	103504537	missense	probably benign	0.10
R4698:Lrrc37a	UTSW	11	103504104	missense	possibly damaging	0.83
R4750:Lrrc37a	UTSW	11	103455480	missense	probably benign	0.24
R4805:Lrrc37a	UTSW	11	103504309	missense	probably benign	0.01
R4940:Lrrc37a	UTSW	11	103497612	missense	unknown
R4983:Lrrc37a	UTSW	11	103497618	missense	unknown
R4989:Lrrc37a	UTSW	11	103456739	missense	unknown
R5046:Lrrc37a	UTSW	11	103498240	missense	unknown
R5217:Lrrc37a	UTSW	11	103456954	missense	unknown
R5300:Lrrc37a	UTSW	11	103456958	missense	unknown
R5509:Lrrc37a	UTSW	11	103500535	missense	probably benign	0.23
R5550:Lrrc37a	UTSW	11	103498177	missense	unknown
R5655:Lrrc37a	UTSW	11	103498555	missense	probably benign	0.28
R5668:Lrrc37a	UTSW	11	103500175	missense	probably benign	0.03
R5750:Lrrc37a	UTSW	11	103458097	missense	unknown
R5815:Lrrc37a	UTSW	11	103503786	missense	probably benign	0.01
R5976:Lrrc37a	UTSW	11	103499071	missense	possibly damaging	0.73
R5990:Lrrc37a	UTSW	11	103500958	missense	probably benign	0.19
R6004:Lrrc37a	UTSW	11	103502536	missense	possibly damaging	0.56
R6019:Lrrc37a	UTSW	11	103456596	missense	unknown
R6056:Lrrc37a	UTSW	11	103497658	missense	unknown
R6125:Lrrc37a	UTSW	11	103501560	missense	probably benign	0.19
R6190:Lrrc37a	UTSW	11	103501216	missense	possibly damaging	0.67
R6295:Lrrc37a	UTSW	11	103497633	missense	unknown
R6320:Lrrc37a	UTSW	11	103504051	missense	probably benign	0.10
R6354:Lrrc37a	UTSW	11	103464387	missense	unknown
R6375:Lrrc37a	UTSW	11	103501089	missense	probably benign	0.19
R6406:Lrrc37a	UTSW	11	103497535	missense	unknown
R6468:Lrrc37a	UTSW	11	103460840	missense	unknown
R6490:Lrrc37a	UTSW	11	103456660	missense	unknown
R6502:Lrrc37a	UTSW	11	103492179	missense	unknown
R6509:Lrrc37a	UTSW	11	103504414	missense	probably benign	0.04
R6768:Lrrc37a	UTSW	11	103500123	missense	probably benign	0.36
R6912:Lrrc37a	UTSW	11	103457543	missense	unknown
R7081:Lrrc37a	UTSW	11	103457955	missense	unknown
R7083:Lrrc37a	UTSW	11	103503340	missense	probably benign	0.03
R7154:Lrrc37a	UTSW	11	103502856	missense	probably benign	0.03
R7195:Lrrc37a	UTSW	11	103457775	missense	unknown
R7265:Lrrc37a	UTSW	11	103498941	missense	probably benign	0.09
R7276:Lrrc37a	UTSW	11	103456746	missense	unknown
R7362:Lrrc37a	UTSW	11	103457509	missense	unknown
R7450:Lrrc37a	UTSW	11	103498326	missense	probably benign	0.01
R7458:Lrrc37a	UTSW	11	103497432	missense	unknown
R7487:Lrrc37a	UTSW	11	103498219	missense	unknown
R7535:Lrrc37a	UTSW	11	103501857	missense	possibly damaging	0.68
R7593:Lrrc37a	UTSW	11	103500952	missense	probably benign	0.03
R7677:Lrrc37a	UTSW	11	103499638	missense	probably benign	0.26
R7686:Lrrc37a	UTSW	11	103498236	missense	unknown
R7694:Lrrc37a	UTSW	11	103504378	missense	probably benign	0.12
R7696:Lrrc37a	UTSW	11	103498437	missense	probably benign	0.01
R7717:Lrrc37a	UTSW	11	103504300	missense	probably benign	0.01
R7736:Lrrc37a	UTSW	11	103497459	missense	unknown
R7841:Lrrc37a	UTSW	11	103501105	missense	probably benign	0.03
R7885:Lrrc37a	UTSW	11	103503042	missense	probably benign	0.01
R7888:Lrrc37a	UTSW	11	103501481	missense	probably benign	0.19
R7993:Lrrc37a	UTSW	11	103457961	missense	unknown
R8051:Lrrc37a	UTSW	11	103503126	missense	possibly damaging	0.48
R8082:Lrrc37a	UTSW	11	103457422	missense	unknown
R8097:Lrrc37a	UTSW	11	103504099	missense	probably benign	0.04
R8108:Lrrc37a	UTSW	11	103503057	missense	probably benign	0.24
R8269:Lrrc37a	UTSW	11	103497898	missense	unknown
R8311:Lrrc37a	UTSW	11	103503421	missense	probably benign	0.05
R8403:Lrrc37a	UTSW	11	103501585	missense	probably benign	0.10
R8408:Lrrc37a	UTSW	11	103460809	missense	unknown
R8529:Lrrc37a	UTSW	11	103457547	missense	unknown
R8711:Lrrc37a	UTSW	11	103497524	nonsense	probably null
R8757:Lrrc37a	UTSW	11	103457940	missense	unknown
R8759:Lrrc37a	UTSW	11	103457940	missense	unknown
R8769:Lrrc37a	UTSW	11	103498710	missense	probably benign	0.10
R8785:Lrrc37a	UTSW	11	103456416	missense	probably damaging	1.00
R8837:Lrrc37a	UTSW	11	103503969	missense	probably benign	0.43
R8850:Lrrc37a	UTSW	11	103502655	missense
R8871:Lrrc37a	UTSW	11	103456549	missense	unknown
R8894:Lrrc37a	UTSW	11	103456623	missense	unknown
R8971:Lrrc37a	UTSW	11	103500664	missense	probably benign	0.19
R8979:Lrrc37a	UTSW	11	103503007	missense	possibly damaging	0.48
R9012:Lrrc37a	UTSW	11	103499152	missense	probably benign	0.05
R9047:Lrrc37a	UTSW	11	103500549	missense	probably damaging	0.97
R9167:Lrrc37a	UTSW	11	103456832	missense	unknown
R9171:Lrrc37a	UTSW	11	103502314	missense	probably benign	0.42
R9194:Lrrc37a	UTSW	11	103500850	missense	probably benign	0.03
R9258:Lrrc37a	UTSW	11	103502196	missense	probably benign	0.20
R9282:Lrrc37a	UTSW	11	103500807	missense	probably benign	0.03
R9294:Lrrc37a	UTSW	11	103504533	missense	probably benign	0.10
R9349:Lrrc37a	UTSW	11	103497628	missense	unknown
R9560:Lrrc37a	UTSW	11	103456594	missense	unknown
R9595:Lrrc37a	UTSW	11	103501726	missense	probably benign	0.01
R9628:Lrrc37a	UTSW	11	103503504	missense	probably benign	0.03
V7580:Lrrc37a	UTSW	11	103455512	missense	possibly damaging	0.95
X0018:Lrrc37a	UTSW	11	103499544	missense	possibly damaging	0.78
Z1176:Lrrc37a	UTSW	11	103456486	missense	probably damaging	1.00
Z1176:Lrrc37a	UTSW	11	103499034	missense	possibly damaging	0.68
Z1176:Lrrc37a	UTSW	11	103501094	missense	probably benign	0.09
Z1177:Lrrc37a	UTSW	11	103499967	missense	possibly damaging	0.46
Z1177:Lrrc37a	UTSW	11	103500520	missense	probably benign	0.43
Z1177:Lrrc37a	UTSW	11	103500598	missense	probably benign	0.20
Z1177:Lrrc37a	UTSW	11	103503027	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- GACAAGTTACCCTGCTGACC -3'
(R):5'- CTCTAAGTCAGCAGAAGAGCAC -3'

Sequencing Primer
(F):5'- AGTTACCCTGCTGACCTGAAG -3'
(R):5'- AATCCGGAGCTCCTAGAGG -3'

Posted On

2018-08-29