Mutagenetix > Incidental Mutation

Incidental Mutation 'R6749:Aatk'

532900

Institutional Source

Beutler Lab

Gene Symbol

Aatk

Ensembl Gene

ENSMUSG00000025375

Gene Name

apoptosis-associated tyrosine kinase

Synonyms

AATYK1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R6749 (G1)

Quality Score

221.009

Status

Validated

Chromosome

Chromosomal Location

120007313-120047167 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120010774 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 875 (V875A)

Ref Sequence

ENSEMBL: ENSMUSP00000099309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026436] [ENSMUST00000064307] [ENSMUST00000103019] [ENSMUST00000103020] [ENSMUST00000106233]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000026436

SMART Domains

Protein: ENSMUSP00000026436
Gene: ENSMUSG00000025372

Domain	Start	End	E-Value	Type
Pfam:IMD	17	237	6e-101	PFAM
PDB:4JS0\|B	261	292	2e-13	PDB
low complexity region	321	335	N/A	INTRINSIC
SH3	378	437	9.77e-11	SMART
low complexity region	459	471	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064307
AA Change: V932A

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000067181
Gene: ENSMUSG00000025375
AA Change: V932A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	30	49	N/A	INTRINSIC
Pfam:Pkinase_Tyr	135	405	3.9e-63	PFAM
Pfam:Pkinase	136	404	2.6e-33	PFAM
low complexity region	425	457	N/A	INTRINSIC
low complexity region	502	514	N/A	INTRINSIC
low complexity region	615	624	N/A	INTRINSIC
low complexity region	647	666	N/A	INTRINSIC
low complexity region	684	695	N/A	INTRINSIC
low complexity region	808	819	N/A	INTRINSIC
low complexity region	913	927	N/A	INTRINSIC
low complexity region	934	943	N/A	INTRINSIC
low complexity region	985	1004	N/A	INTRINSIC
low complexity region	1063	1082	N/A	INTRINSIC
low complexity region	1085	1096	N/A	INTRINSIC
low complexity region	1160	1174	N/A	INTRINSIC
low complexity region	1179	1204	N/A	INTRINSIC
low complexity region	1319	1333	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103019
AA Change: V875A

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099308
Gene: ENSMUSG00000025375
AA Change: V875A

Domain	Start	End	E-Value	Type
Pfam:Pkinase	78	347	3e-36	PFAM
Pfam:Pkinase_Tyr	78	348	1.9e-62	PFAM
low complexity region	368	400	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	558	567	N/A	INTRINSIC
low complexity region	590	609	N/A	INTRINSIC
low complexity region	627	638	N/A	INTRINSIC
low complexity region	751	762	N/A	INTRINSIC
low complexity region	856	870	N/A	INTRINSIC
low complexity region	877	886	N/A	INTRINSIC
low complexity region	928	947	N/A	INTRINSIC
low complexity region	1006	1025	N/A	INTRINSIC
low complexity region	1028	1039	N/A	INTRINSIC
low complexity region	1103	1117	N/A	INTRINSIC
low complexity region	1122	1147	N/A	INTRINSIC
low complexity region	1262	1276	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103020
AA Change: V875A

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099309
Gene: ENSMUSG00000025375
AA Change: V875A

Domain	Start	End	E-Value	Type
Pfam:Pkinase	78	347	3e-36	PFAM
Pfam:Pkinase_Tyr	78	348	1.9e-62	PFAM
low complexity region	368	400	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	558	567	N/A	INTRINSIC
low complexity region	590	609	N/A	INTRINSIC
low complexity region	627	638	N/A	INTRINSIC
low complexity region	751	762	N/A	INTRINSIC
low complexity region	856	870	N/A	INTRINSIC
low complexity region	877	886	N/A	INTRINSIC
low complexity region	928	947	N/A	INTRINSIC
low complexity region	1006	1025	N/A	INTRINSIC
low complexity region	1028	1039	N/A	INTRINSIC
low complexity region	1103	1117	N/A	INTRINSIC
low complexity region	1122	1147	N/A	INTRINSIC
low complexity region	1262	1276	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106233

SMART Domains

Protein: ENSMUSP00000101840
Gene: ENSMUSG00000025372

Domain	Start	End	E-Value	Type
Pfam:IMD	17	237	1.6e-98	PFAM
PDB:4JS0\|B	261	292	8e-14	PDB
low complexity region	321	335	N/A	INTRINSIC
SH3	378	437	9.77e-11	SMART
low complexity region	459	471	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a tyrosine kinase domain at the N-terminus and a proline-rich domain at the C-terminus. This gene is induced during apoptosis, and expression of this gene may be a necessary pre-requisite for the induction of growth arrest and/or apoptosis of myeloid precursor cells. This gene has been shown to produce neuronal differentiation in a neuroblastoma cell line. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased brain size, longer axons and fewer neurites. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef15	A	T	11: 68,954,557	F156L	probably damaging	Het
Bdh2	T	A	3: 135,300,691	S184T	probably damaging	Het
Bmp5	A	T	9: 75,776,093	M1L	probably benign	Het
Cacfd1	T	C	2: 27,018,455	Y134H	probably damaging	Het
Camk1	G	A	6: 113,334,525	P340L	probably benign	Het
Ccdc105	A	C	10: 78,752,838	M46R	possibly damaging	Het
Cdc14a	T	C	3: 116,297,158	H424R	possibly damaging	Het
Cntfr	T	A	4: 41,663,232	T192S	possibly damaging	Het
Erbin	G	T	13: 103,834,377	S910R	probably damaging	Het
Esrp1	A	T	4: 11,357,519	V366E	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fsip2	T	A	2: 82,978,394	S1686T	possibly damaging	Het
Gata5	A	G	2: 180,334,350	L7S	probably damaging	Het
Hgf	T	A	5: 16,613,642		probably null	Het
Ift140	A	G	17: 25,098,916	E1458G	probably damaging	Het
Ift57	G	A	16: 49,760,984	G209R	probably benign	Het
Il12rb2	G	T	6: 67,361,966		probably benign	Het
Krt78	G	A	15: 101,950,923	R280C	probably damaging	Het
Lipc	A	G	9: 70,823,386	I88T	probably damaging	Het
Lrmda	G	T	14: 22,027,276	R27L	probably benign	Het
Lrrc37a	T	G	11: 103,502,097	E834A	probably benign	Het
Mmachc	C	A	4: 116,704,541	R132L	probably damaging	Het
Myo10	T	C	15: 25,714,110	Y88H	probably damaging	Het
Myo5b	G	A	18: 74,701,503	R878Q	possibly damaging	Het
Olfr1392	A	G	11: 49,294,050	H243R	probably damaging	Het
Padi3	T	C	4: 140,795,853	T289A	possibly damaging	Het
Pcdhgb4	G	T	18: 37,721,229	A226S	possibly damaging	Het
Pde4c	T	C	8: 70,746,010	V167A	probably damaging	Het
Pigr	A	G	1: 130,846,548	T422A	probably benign	Het
Pmp2	T	C	3: 10,182,482	Y49C	probably benign	Het
Prpf39	A	G	12: 65,056,274	I441V	possibly damaging	Het
Ptprs	A	G	17: 56,437,884	V284A	probably damaging	Het
Rsad1	T	C	11: 94,543,340	E354G	probably damaging	Het
Sema4b	T	A	7: 80,220,201	D412E	possibly damaging	Het
Siglecg	A	G	7: 43,408,979	I97V	probably benign	Het
Slc4a3	C	T	1: 75,554,538	R792*	probably null	Het
Slc6a20a	A	G	9: 123,637,070	C569R	probably damaging	Het
Spata19	T	C	9: 27,397,980	V59A	probably benign	Het
Sult2a3	T	A	7: 14,082,704	Y183F	probably benign	Het
Tedc1	C	T	12: 113,158,082	T194M	probably damaging	Het
Tmem63c	T	A	12: 87,075,665	N412K	probably damaging	Het
Trav5-1	T	C	14: 52,622,945	I69T	possibly damaging	Het
Trim68	T	C	7: 102,678,783	D321G	probably damaging	Het
Ttn	T	C	2: 76,865,256		probably benign	Het
Vars2	A	G	17: 35,666,713	V109A	probably damaging	Het
Vmn2r96	C	T	17: 18,598,090	P643L	probably damaging	Het
Zfpm2	G	T	15: 40,954,708	V146F	possibly damaging	Het
Znfx1	T	C	2: 167,056,599	K135R	probably benign	Het

Other mutations in Aatk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Aatk	APN	11	120010186	missense	probably benign	0.02
IGL00953:Aatk	APN	11	120011221	missense	probably benign	0.00
IGL01019:Aatk	APN	11	120012275	missense	probably benign
IGL01758:Aatk	APN	11	120010819	missense	possibly damaging	0.86
IGL02377:Aatk	APN	11	120046863	utr 5 prime	probably benign
IGL02902:Aatk	APN	11	120011777	missense	probably benign	0.00
IGL03067:Aatk	APN	11	120010083	missense	probably benign	0.00
IGL03116:Aatk	APN	11	120016751	missense	probably benign	0.14
IGL03279:Aatk	APN	11	120013678	missense	probably damaging	1.00
IGL03405:Aatk	APN	11	120016403	missense	probably benign	0.02
PIT4366001:Aatk	UTSW	11	120010960	missense	possibly damaging	0.55
PIT4802001:Aatk	UTSW	11	120011346	missense	probably benign
R0101:Aatk	UTSW	11	120010913	missense	probably benign	0.19
R0497:Aatk	UTSW	11	120018780	missense	probably damaging	0.99
R0535:Aatk	UTSW	11	120010193	missense	probably benign	0.00
R0638:Aatk	UTSW	11	120009922	missense	probably damaging	1.00
R0939:Aatk	UTSW	11	120012143	missense	probably damaging	0.99
R1475:Aatk	UTSW	11	120010888	missense	probably damaging	0.96
R1840:Aatk	UTSW	11	120013732	missense	probably damaging	1.00
R1865:Aatk	UTSW	11	120010222	missense	probably benign	0.00
R1982:Aatk	UTSW	11	120013514	missense	probably damaging	1.00
R2027:Aatk	UTSW	11	120009317	missense	probably damaging	1.00
R2115:Aatk	UTSW	11	120009736	missense	probably benign
R2220:Aatk	UTSW	11	120012177	missense	probably damaging	1.00
R2264:Aatk	UTSW	11	120010274	missense	probably damaging	1.00
R2504:Aatk	UTSW	11	120018855	missense	probably benign	0.00
R3872:Aatk	UTSW	11	120010219	missense	possibly damaging	0.71
R4551:Aatk	UTSW	11	120011569	missense	probably benign	0.03
R4657:Aatk	UTSW	11	120013478	missense	possibly damaging	0.69
R4744:Aatk	UTSW	11	120016122	missense	possibly damaging	0.64
R4924:Aatk	UTSW	11	120011525	missense	probably damaging	1.00
R5063:Aatk	UTSW	11	120010489	missense	probably benign	0.07
R5223:Aatk	UTSW	11	120013452	missense	possibly damaging	0.95
R5243:Aatk	UTSW	11	120016768	missense	probably damaging	1.00
R5376:Aatk	UTSW	11	120012034	missense	probably damaging	0.98
R5442:Aatk	UTSW	11	120018768	missense	probably benign	0.02
R5550:Aatk	UTSW	11	120009303	missense	probably benign	0.42
R5678:Aatk	UTSW	11	120010154	missense	probably benign	0.00
R5932:Aatk	UTSW	11	120021533	missense	probably damaging	1.00
R6026:Aatk	UTSW	11	120012364	missense	possibly damaging	0.65
R6129:Aatk	UTSW	11	120021533	missense	probably damaging	1.00
R6409:Aatk	UTSW	11	120011732	missense	probably benign	0.01
R6477:Aatk	UTSW	11	120018870	missense	probably benign	0.00
R6478:Aatk	UTSW	11	120010991	missense	probably benign	0.00
R6753:Aatk	UTSW	11	120010151	missense	probably benign
R6787:Aatk	UTSW	11	120010682	missense	probably damaging	1.00
R6852:Aatk	UTSW	11	120010468	missense	probably benign	0.10
R7114:Aatk	UTSW	11	120009619	missense	probably benign
R7557:Aatk	UTSW	11	120009430	missense	possibly damaging	0.73
R7818:Aatk	UTSW	11	120021455	missense	probably benign
R7954:Aatk	UTSW	11	120012343	missense	possibly damaging	0.51
R8176:Aatk	UTSW	11	120016415	missense	probably damaging	0.99
R8420:Aatk	UTSW	11	120046920	missense	unknown
R8963:Aatk	UTSW	11	120012137	missense	probably damaging	1.00
R9090:Aatk	UTSW	11	120011114	missense	probably damaging	0.98
R9167:Aatk	UTSW	11	120011126	missense	possibly damaging	0.90
R9271:Aatk	UTSW	11	120011114	missense	probably damaging	0.98
R9357:Aatk	UTSW	11	120010870	missense	probably benign	0.01
R9373:Aatk	UTSW	11	120015517	missense	possibly damaging	0.95
R9420:Aatk	UTSW	11	120021451	missense	probably benign	0.01
R9423:Aatk	UTSW	11	120010694	missense	probably damaging	1.00
R9476:Aatk	UTSW	11	120010268	missense	probably benign	0.01
R9510:Aatk	UTSW	11	120010268	missense	probably benign	0.01
R9519:Aatk	UTSW	11	120021483	start gained	probably benign
R9605:Aatk	UTSW	11	120011383	missense	possibly damaging	0.88
R9649:Aatk	UTSW	11	120010907	missense	probably damaging	1.00
R9766:Aatk	UTSW	11	120011739	missense	probably benign	0.00
X0064:Aatk	UTSW	11	120011176	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- AGTAGGCAGAGTCTCGGTAG -3'
(R):5'- AAGCGCTCCTGACATCCTAC -3'

Sequencing Primer
(F):5'- TTCTTGCTGAGGCCACCAAG -3'
(R):5'- CAGTTCTCTGGGGCAAGAG -3'

Posted On

2018-08-29