Incidental Mutation 'R6749:Tmem63c'
ID532902
Institutional Source Beutler Lab
Gene Symbol Tmem63c
Ensembl Gene ENSMUSG00000034145
Gene Nametransmembrane protein 63c
Synonyms9330187M14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location87021340-87090043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87075665 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 412 (N412K)
Ref Sequence ENSEMBL: ENSMUSP00000119872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110187] [ENSMUST00000131878] [ENSMUST00000146292] [ENSMUST00000154801]
Predicted Effect probably damaging
Transcript: ENSMUST00000110187
AA Change: N412K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105816
Gene: ENSMUSG00000034145
AA Change: N412K

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 9.5e-21 PFAM
Pfam:DUF4463 253 323 6.1e-16 PFAM
Pfam:DUF221 341 680 8.9e-89 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131878
AA Change: N412K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117023
Gene: ENSMUSG00000034145
AA Change: N412K

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 9.5e-21 PFAM
Pfam:DUF4463 253 323 6.1e-16 PFAM
Pfam:DUF221 341 680 8.9e-89 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146292
AA Change: N412K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119872
Gene: ENSMUSG00000034145
AA Change: N412K

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 1.6e-20 PFAM
Pfam:PHM7_cyt 253 323 6e-12 PFAM
Pfam:RSN1_7TM 341 680 2.5e-88 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154801
SMART Domains Protein: ENSMUSP00000119898
Gene: ENSMUSG00000034145

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 179 1.6e-16 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Tmem63c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Tmem63c APN 12 87077206 missense probably benign 0.05
IGL00837:Tmem63c APN 12 87077197 missense probably benign
IGL01317:Tmem63c APN 12 87071996 splice site probably benign
IGL01521:Tmem63c APN 12 87069144 missense probably damaging 0.99
IGL01955:Tmem63c APN 12 87077208 missense probably benign 0.00
IGL02007:Tmem63c APN 12 87072873 missense probably damaging 1.00
IGL02891:Tmem63c APN 12 87071268 missense probably benign 0.00
IGL03102:Tmem63c APN 12 87065549 missense probably benign 0.42
IGL03273:Tmem63c APN 12 87081802 missense probably damaging 1.00
R0238:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0238:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0239:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0239:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0975:Tmem63c UTSW 12 87075069 splice site probably benign
R2398:Tmem63c UTSW 12 87056533 missense probably damaging 1.00
R4416:Tmem63c UTSW 12 87081902 missense probably benign 0.14
R4721:Tmem63c UTSW 12 87057180 missense possibly damaging 0.70
R4881:Tmem63c UTSW 12 87086418 missense possibly damaging 0.67
R4888:Tmem63c UTSW 12 87089365 missense probably damaging 1.00
R5210:Tmem63c UTSW 12 87089398 missense probably benign 0.10
R5277:Tmem63c UTSW 12 87057757 unclassified probably null
R5790:Tmem63c UTSW 12 87057636 missense probably benign 0.10
R5855:Tmem63c UTSW 12 87075726 missense probably damaging 1.00
R5940:Tmem63c UTSW 12 87075172 missense probably benign
R6000:Tmem63c UTSW 12 87057197 missense probably damaging 1.00
R6240:Tmem63c UTSW 12 87076405 missense possibly damaging 0.67
R6268:Tmem63c UTSW 12 87081953 missense probably damaging 1.00
R7380:Tmem63c UTSW 12 87077948 missense probably benign 0.00
R7472:Tmem63c UTSW 12 87069158 missense possibly damaging 0.50
R8057:Tmem63c UTSW 12 87072198 nonsense probably null
R8184:Tmem63c UTSW 12 87061554 missense possibly damaging 0.93
Z1176:Tmem63c UTSW 12 87056485 missense probably benign 0.01
Z1177:Tmem63c UTSW 12 87077264 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCCTGAGCTTTCACAGATGG -3'
(R):5'- AATCTCCACCATGCTGTTGTTG -3'

Sequencing Primer
(F):5'- TGGTGTCAAGGAAAGAGCCC -3'
(R):5'- CTCCACCATGCTGTTGTTGTAAAAG -3'
Posted On2018-08-29