Incidental Mutation 'R6749:Tedc1'
ID532903
Institutional Source Beutler Lab
Gene Symbol Tedc1
Ensembl Gene ENSMUSG00000037466
Gene Nametubulin epsilon and delta complex 1
Synonyms4930427A07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location113156421-113166048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113158082 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 194 (T194M)
Ref Sequence ENSEMBL: ENSMUSP00000035351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006523] [ENSMUST00000049271] [ENSMUST00000196755] [ENSMUST00000199089] [ENSMUST00000200522] [ENSMUST00000200553]
Predicted Effect probably benign
Transcript: ENSMUST00000006523
SMART Domains Protein: ENSMUSP00000006523
Gene: ENSMUSG00000006360

DomainStartEndE-ValueType
LIM 3 55 2e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000049271
AA Change: T194M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035351
Gene: ENSMUSG00000037466
AA Change: T194M

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:DUF4509 41 221 4.8e-65 PFAM
low complexity region 233 245 N/A INTRINSIC
Pfam:DUF4510 258 418 3.1e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196755
SMART Domains Protein: ENSMUSP00000143431
Gene: ENSMUSG00000037466

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
Pfam:DUF4509 40 138 4.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199089
SMART Domains Protein: ENSMUSP00000142803
Gene: ENSMUSG00000006360

DomainStartEndE-ValueType
LIM 54 106 9.5e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200522
Predicted Effect probably benign
Transcript: ENSMUST00000200553
SMART Domains Protein: ENSMUSP00000143680
Gene: ENSMUSG00000006360

DomainStartEndE-ValueType
LIM 3 55 2e-14 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Tedc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tedc1 APN 12 113163150 missense probably damaging 0.97
IGL01074:Tedc1 APN 12 113163188 nonsense probably null
IGL01075:Tedc1 APN 12 113163188 nonsense probably null
IGL01077:Tedc1 APN 12 113163188 nonsense probably null
IGL01084:Tedc1 APN 12 113163188 nonsense probably null
IGL01103:Tedc1 APN 12 113163188 nonsense probably null
IGL01108:Tedc1 APN 12 113163188 nonsense probably null
IGL01137:Tedc1 APN 12 113163188 nonsense probably null
IGL01142:Tedc1 APN 12 113163188 nonsense probably null
IGL01149:Tedc1 APN 12 113163188 nonsense probably null
IGL01150:Tedc1 APN 12 113163188 nonsense probably null
IGL01151:Tedc1 APN 12 113163188 nonsense probably null
IGL02646:Tedc1 APN 12 113157301 missense possibly damaging 0.68
IGL02989:Tedc1 APN 12 113163321 missense probably benign 0.09
ANU05:Tedc1 UTSW 12 113163188 nonsense probably null
ANU22:Tedc1 UTSW 12 113163188 nonsense probably null
R1309:Tedc1 UTSW 12 113161780 missense probably benign
R1555:Tedc1 UTSW 12 113156497 unclassified probably benign
R2092:Tedc1 UTSW 12 113157720 missense probably damaging 1.00
R3053:Tedc1 UTSW 12 113156467 unclassified probably benign
R4130:Tedc1 UTSW 12 113163208 missense probably benign 0.01
R5050:Tedc1 UTSW 12 113156705 missense possibly damaging 0.86
R5386:Tedc1 UTSW 12 113156682 missense probably benign 0.03
R6377:Tedc1 UTSW 12 113161355 missense probably damaging 1.00
R6761:Tedc1 UTSW 12 113161714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCTGTGTCCTGGTGAGC -3'
(R):5'- AACAAACGACAGTGATTGGCTG -3'

Sequencing Primer
(F):5'- AAGCCCTCGGTGAAGTTGTC -3'
(R):5'- TGTCAAAGCCTAACACCAGC -3'
Posted On2018-08-29