Incidental Mutation 'R6749:Lrmda'
ID532905
Institutional Source Beutler Lab
Gene Symbol Lrmda
Ensembl Gene ENSMUSG00000063458
Gene Nameleucine rich melanocyte differentiation associated
SynonymsOca7, 1700112E06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location22019712-23056085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 22027276 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 27 (R27L)
Ref Sequence ENSEMBL: ENSMUSP00000075065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075639] [ENSMUST00000159777] [ENSMUST00000161249] [ENSMUST00000162540]
Predicted Effect probably benign
Transcript: ENSMUST00000075639
AA Change: R27L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000075065
Gene: ENSMUSG00000063458
AA Change: R27L

DomainStartEndE-ValueType
low complexity region 55 82 N/A INTRINSIC
LRRcap 129 147 6.28e-1 SMART
low complexity region 167 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159777
AA Change: R27L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125751
Gene: ENSMUSG00000063458
AA Change: R27L

DomainStartEndE-ValueType
SCOP:d1h6ua2 34 109 1e-8 SMART
LRRcap 129 147 6.28e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161249
AA Change: R27L
SMART Domains Protein: ENSMUSP00000124221
Gene: ENSMUSG00000063458
AA Change: R27L

DomainStartEndE-ValueType
low complexity region 78 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162540
AA Change: R27L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124436
Gene: ENSMUSG00000063458
AA Change: R27L

DomainStartEndE-ValueType
low complexity region 55 82 N/A INTRINSIC
LRRcap 129 147 6.28e-1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich repeat protein. The encoded protein is thought to play a role in melanocyte differentiation. Mutations in this gene have been associated with autosomal recessive oculocutaneous albinism 7 (OCA7). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Lrmda
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Lrmda APN 14 22596517 missense possibly damaging 0.49
IGL01982:Lrmda APN 14 22584482 missense probably damaging 1.00
IGL02792:Lrmda APN 14 22019910 critical splice donor site probably null
IGL02826:Lrmda APN 14 22828737 missense probably damaging 1.00
Bowie UTSW 14 22027235 nonsense probably null
Stardust UTSW 14 22027306 missense probably damaging 1.00
R1921:Lrmda UTSW 14 22577870 missense probably damaging 1.00
R3720:Lrmda UTSW 14 22027331 splice site probably benign
R3722:Lrmda UTSW 14 22027331 splice site probably benign
R4242:Lrmda UTSW 14 22027235 nonsense probably null
R5393:Lrmda UTSW 14 22027306 missense probably damaging 1.00
R6562:Lrmda UTSW 14 22598186 intron probably benign
R7155:Lrmda UTSW 14 22584540 missense probably damaging 1.00
R7560:Lrmda UTSW 14 22828702 missense probably benign 0.15
R7580:Lrmda UTSW 14 22019857 start gained probably benign
R7885:Lrmda UTSW 14 22598320 missense unknown
R7920:Lrmda UTSW 14 22596478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCACTGTGACAGGAAAGG -3'
(R):5'- AAGATCGTTTGCAGCAGGGTC -3'

Sequencing Primer
(F):5'- TTGGCAGAGTCCCCCTAAGAG -3'
(R):5'- CTGGTGTGTGGTCTCATCTTTCTC -3'
Posted On2018-08-29