Mutagenetix > Incidental Mutation

Incidental Mutation 'R6749:Myo10'

532907

Institutional Source

Beutler Lab

Gene Symbol

Myo10

Ensembl Gene

ENSMUSG00000022272

Gene Name

myosin X

Synonyms

D15Ertd600e, myosin-X

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6749 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25622525-25813673 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25714110 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 88 (Y88H)

Ref Sequence

ENSEMBL: ENSMUSP00000118280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110457] [ENSMUST00000137601]

AlphaFold

F8VQB6

Predicted Effect

probably damaging
Transcript: ENSMUST00000110457
AA Change: Y121H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106087
Gene: ENSMUSG00000022272
AA Change: Y121H

Domain	Start	End	E-Value	Type
MYSc	57	740	N/A	SMART
IQ	741	763	1.27e-3	SMART
IQ	764	786	1.06e0	SMART
IQ	787	809	7.07e-2	SMART
Pfam:MYO10_CC	881	932	4.2e-22	PFAM
low complexity region	959	981	N/A	INTRINSIC
low complexity region	1090	1102	N/A	INTRINSIC
low complexity region	1147	1165	N/A	INTRINSIC
PH	1217	1316	1.39e-21	SMART
PH	1397	1503	6.76e-11	SMART
MyTH4	1551	1699	4.12e-37	SMART
B41	1700	1962	1.72e-44	SMART
low complexity region	2050	2062	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000137601
AA Change: Y88H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118280
Gene: ENSMUSG00000022272
AA Change: Y88H

Domain	Start	End	E-Value	Type
MYSc	24	707	N/A	SMART
IQ	708	730	1.27e-3	SMART
IQ	731	753	1.06e0	SMART
IQ	754	776	7.07e-2	SMART

Meta Mutation Damage Score

0.8609

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutations are semi-lethal with over half of homozygous embryos exhibiting exencephaly. Surviving mutants show decreased body weight, white spotting, syndactyly, persistence of hyaloid vascular system and other eye defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	G	11: 120,010,774	V875A	possibly damaging	Het
Arhgef15	A	T	11: 68,954,557	F156L	probably damaging	Het
Bdh2	T	A	3: 135,300,691	S184T	probably damaging	Het
Bmp5	A	T	9: 75,776,093	M1L	probably benign	Het
Cacfd1	T	C	2: 27,018,455	Y134H	probably damaging	Het
Camk1	G	A	6: 113,334,525	P340L	probably benign	Het
Ccdc105	A	C	10: 78,752,838	M46R	possibly damaging	Het
Cdc14a	T	C	3: 116,297,158	H424R	possibly damaging	Het
Cntfr	T	A	4: 41,663,232	T192S	possibly damaging	Het
Erbin	G	T	13: 103,834,377	S910R	probably damaging	Het
Esrp1	A	T	4: 11,357,519	V366E	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fsip2	T	A	2: 82,978,394	S1686T	possibly damaging	Het
Gata5	A	G	2: 180,334,350	L7S	probably damaging	Het
Hgf	T	A	5: 16,613,642		probably null	Het
Ift140	A	G	17: 25,098,916	E1458G	probably damaging	Het
Ift57	G	A	16: 49,760,984	G209R	probably benign	Het
Il12rb2	G	T	6: 67,361,966		probably benign	Het
Krt78	G	A	15: 101,950,923	R280C	probably damaging	Het
Lipc	A	G	9: 70,823,386	I88T	probably damaging	Het
Lrmda	G	T	14: 22,027,276	R27L	probably benign	Het
Lrrc37a	T	G	11: 103,502,097	E834A	probably benign	Het
Mmachc	C	A	4: 116,704,541	R132L	probably damaging	Het
Myo5b	G	A	18: 74,701,503	R878Q	possibly damaging	Het
Olfr1392	A	G	11: 49,294,050	H243R	probably damaging	Het
Padi3	T	C	4: 140,795,853	T289A	possibly damaging	Het
Pcdhgb4	G	T	18: 37,721,229	A226S	possibly damaging	Het
Pde4c	T	C	8: 70,746,010	V167A	probably damaging	Het
Pigr	A	G	1: 130,846,548	T422A	probably benign	Het
Pmp2	T	C	3: 10,182,482	Y49C	probably benign	Het
Prpf39	A	G	12: 65,056,274	I441V	possibly damaging	Het
Ptprs	A	G	17: 56,437,884	V284A	probably damaging	Het
Rsad1	T	C	11: 94,543,340	E354G	probably damaging	Het
Sema4b	T	A	7: 80,220,201	D412E	possibly damaging	Het
Siglecg	A	G	7: 43,408,979	I97V	probably benign	Het
Slc4a3	C	T	1: 75,554,538	R792*	probably null	Het
Slc6a20a	A	G	9: 123,637,070	C569R	probably damaging	Het
Spata19	T	C	9: 27,397,980	V59A	probably benign	Het
Sult2a3	T	A	7: 14,082,704	Y183F	probably benign	Het
Tedc1	C	T	12: 113,158,082	T194M	probably damaging	Het
Tmem63c	T	A	12: 87,075,665	N412K	probably damaging	Het
Trav5-1	T	C	14: 52,622,945	I69T	possibly damaging	Het
Trim68	T	C	7: 102,678,783	D321G	probably damaging	Het
Ttn	T	C	2: 76,865,256		probably benign	Het
Vars2	A	G	17: 35,666,713	V109A	probably damaging	Het
Vmn2r96	C	T	17: 18,598,090	P643L	probably damaging	Het
Zfpm2	G	T	15: 40,954,708	V146F	possibly damaging	Het
Znfx1	T	C	2: 167,056,599	K135R	probably benign	Het

Other mutations in Myo10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00557:Myo10	APN	15	25776380	missense	probably damaging	1.00
IGL01068:Myo10	APN	15	25739309	missense	possibly damaging	0.93
IGL01352:Myo10	APN	15	25701697	missense	probably damaging	1.00
IGL01388:Myo10	APN	15	25736617	missense	possibly damaging	0.55
IGL01460:Myo10	APN	15	25714108	missense	probably benign	0.00
IGL01553:Myo10	APN	15	25776329	missense	probably damaging	1.00
IGL01732:Myo10	APN	15	25732063	missense	probably benign	0.10
IGL01992:Myo10	APN	15	25799548	missense	possibly damaging	0.92
IGL02000:Myo10	APN	15	25808066	missense	probably damaging	1.00
IGL02045:Myo10	APN	15	25726488	missense	probably benign	0.03
IGL02307:Myo10	APN	15	25776315	splice site	probably benign
IGL02511:Myo10	APN	15	25723889	missense	probably damaging	0.97
IGL03240:Myo10	APN	15	25701602	missense	probably damaging	1.00
least	UTSW	15	25726475	nonsense	probably null
R0037:Myo10	UTSW	15	25666532	intron	probably benign
R0153:Myo10	UTSW	15	25781238	missense	possibly damaging	0.84
R0282:Myo10	UTSW	15	25793167	missense	probably damaging	1.00
R0360:Myo10	UTSW	15	25804368	missense	probably damaging	1.00
R0585:Myo10	UTSW	15	25736455	missense	probably damaging	1.00
R0617:Myo10	UTSW	15	25738005	missense	probably damaging	1.00
R0729:Myo10	UTSW	15	25722157	splice site	probably benign
R0771:Myo10	UTSW	15	25778178	missense	probably damaging	1.00
R0960:Myo10	UTSW	15	25801189	missense	probably damaging	1.00
R1562:Myo10	UTSW	15	25780411	missense	possibly damaging	0.81
R1651:Myo10	UTSW	15	25742369	missense	probably damaging	1.00
R1789:Myo10	UTSW	15	25726525	critical splice donor site	probably null
R1816:Myo10	UTSW	15	25800200	missense	probably damaging	1.00
R1835:Myo10	UTSW	15	25805587	missense	possibly damaging	0.53
R1908:Myo10	UTSW	15	25801222	missense	probably damaging	1.00
R2082:Myo10	UTSW	15	25785993	missense	probably damaging	1.00
R2101:Myo10	UTSW	15	25722259	missense	probably benign	0.26
R2129:Myo10	UTSW	15	25781799	missense	probably benign	0.09
R2141:Myo10	UTSW	15	25714108	missense	probably benign
R2142:Myo10	UTSW	15	25714108	missense	probably benign
R2920:Myo10	UTSW	15	25801140	missense	probably damaging	1.00
R2938:Myo10	UTSW	15	25795717	missense	probably damaging	0.99
R3723:Myo10	UTSW	15	25803288	missense	probably damaging	1.00
R3852:Myo10	UTSW	15	25779626	missense	probably damaging	1.00
R4162:Myo10	UTSW	15	25726415	splice site	probably null
R4163:Myo10	UTSW	15	25726415	splice site	probably null
R4164:Myo10	UTSW	15	25726415	splice site	probably null
R4177:Myo10	UTSW	15	25734051	missense	possibly damaging	0.81
R4409:Myo10	UTSW	15	25807869	missense	probably damaging	1.00
R4667:Myo10	UTSW	15	25793153	missense	possibly damaging	0.91
R4905:Myo10	UTSW	15	25800212	missense	probably damaging	0.99
R4933:Myo10	UTSW	15	25781118	missense	probably damaging	0.96
R4968:Myo10	UTSW	15	25808184	missense	probably damaging	1.00
R5081:Myo10	UTSW	15	25785940	missense	probably damaging	1.00
R5123:Myo10	UTSW	15	25726483	missense	possibly damaging	0.94
R5310:Myo10	UTSW	15	25778078	splice site	probably null
R6073:Myo10	UTSW	15	25736642	missense	probably damaging	1.00
R6117:Myo10	UTSW	15	25805659	missense	probably benign	0.00
R6185:Myo10	UTSW	15	25726510	missense	probably damaging	0.99
R6819:Myo10	UTSW	15	25781410	missense	possibly damaging	0.80
R6875:Myo10	UTSW	15	25805659	missense	probably benign	0.00
R6908:Myo10	UTSW	15	25804383	missense	probably damaging	1.00
R6963:Myo10	UTSW	15	25734063	missense	probably benign	0.31
R7144:Myo10	UTSW	15	25723925	missense	probably damaging	1.00
R7266:Myo10	UTSW	15	25782981	missense	probably damaging	1.00
R7380:Myo10	UTSW	15	25779620	missense	probably benign	0.01
R7460:Myo10	UTSW	15	25807827	missense	probably damaging	1.00
R7614:Myo10	UTSW	15	25701623	missense	probably benign	0.00
R7618:Myo10	UTSW	15	25726475	nonsense	probably null
R7717:Myo10	UTSW	15	25731970	missense	probably benign	0.01
R7811:Myo10	UTSW	15	25804524	missense	probably damaging	1.00
R7830:Myo10	UTSW	15	25737971	nonsense	probably null
R7862:Myo10	UTSW	15	25666436	missense	probably damaging	1.00
R8232:Myo10	UTSW	15	25804314	missense	possibly damaging	0.89
R8264:Myo10	UTSW	15	25800109	missense	probably damaging	0.99
R8377:Myo10	UTSW	15	25804395	missense	possibly damaging	0.94
R8385:Myo10	UTSW	15	25804398	missense	probably damaging	1.00
R8426:Myo10	UTSW	15	25799490	missense	probably damaging	0.99
R8439:Myo10	UTSW	15	25725072	missense	probably benign	0.00
R8696:Myo10	UTSW	15	25799486	missense	probably damaging	1.00
R8775:Myo10	UTSW	15	25800059	missense	probably damaging	0.97
R8775-TAIL:Myo10	UTSW	15	25800059	missense	probably damaging	0.97
R8970:Myo10	UTSW	15	25803381	missense	possibly damaging	0.82
R9024:Myo10	UTSW	15	25793209	missense	possibly damaging	0.53
R9196:Myo10	UTSW	15	25805630	missense	probably damaging	0.96
R9224:Myo10	UTSW	15	25807995	missense	probably benign	0.33
R9308:Myo10	UTSW	15	25781776	missense	probably damaging	0.99
R9358:Myo10	UTSW	15	25781434	missense	possibly damaging	0.69
R9606:Myo10	UTSW	15	25776315	frame shift	probably null
R9722:Myo10	UTSW	15	25801141	missense	probably damaging	1.00
RF013:Myo10	UTSW	15	25799479	missense	probably damaging	0.99
Z1177:Myo10	UTSW	15	25781401	missense	probably damaging	1.00
Z1177:Myo10	UTSW	15	25799554	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATCATTTCGCTGGATCGCTC -3'
(R):5'- AATCTGTCTGCAACTGAGCGC -3'

Sequencing Primer
(F):5'- CTGGATCGCTCCCGCCC -3'
(R):5'- GAGCGCTCTCCAGTGAATG -3'

Posted On

2018-08-29