Incidental Mutation 'R6749:Myo10'
ID532907
Institutional Source Beutler Lab
Gene Symbol Myo10
Ensembl Gene ENSMUSG00000022272
Gene Namemyosin X
SynonymsD15Ertd600e, myosin-X
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location25622525-25813673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25714110 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 88 (Y88H)
Ref Sequence ENSEMBL: ENSMUSP00000118280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110457] [ENSMUST00000137601]
Predicted Effect probably damaging
Transcript: ENSMUST00000110457
AA Change: Y121H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106087
Gene: ENSMUSG00000022272
AA Change: Y121H

DomainStartEndE-ValueType
MYSc 57 740 N/A SMART
IQ 741 763 1.27e-3 SMART
IQ 764 786 1.06e0 SMART
IQ 787 809 7.07e-2 SMART
Pfam:MYO10_CC 881 932 4.2e-22 PFAM
low complexity region 959 981 N/A INTRINSIC
low complexity region 1090 1102 N/A INTRINSIC
low complexity region 1147 1165 N/A INTRINSIC
PH 1217 1316 1.39e-21 SMART
PH 1397 1503 6.76e-11 SMART
MyTH4 1551 1699 4.12e-37 SMART
B41 1700 1962 1.72e-44 SMART
low complexity region 2050 2062 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137601
AA Change: Y88H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118280
Gene: ENSMUSG00000022272
AA Change: Y88H

DomainStartEndE-ValueType
MYSc 24 707 N/A SMART
IQ 708 730 1.27e-3 SMART
IQ 731 753 1.06e0 SMART
IQ 754 776 7.07e-2 SMART
Meta Mutation Damage Score 0.8609 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutations are semi-lethal with over half of homozygous embryos exhibiting exencephaly. Surviving mutants show decreased body weight, white spotting, syndactyly, persistence of hyaloid vascular system and other eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Myo10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Myo10 APN 15 25776380 missense probably damaging 1.00
IGL01068:Myo10 APN 15 25739309 missense possibly damaging 0.93
IGL01352:Myo10 APN 15 25701697 missense probably damaging 1.00
IGL01388:Myo10 APN 15 25736617 missense possibly damaging 0.55
IGL01460:Myo10 APN 15 25714108 missense probably benign 0.00
IGL01553:Myo10 APN 15 25776329 missense probably damaging 1.00
IGL01732:Myo10 APN 15 25732063 missense probably benign 0.10
IGL01992:Myo10 APN 15 25799548 missense possibly damaging 0.92
IGL02000:Myo10 APN 15 25808066 missense probably damaging 1.00
IGL02045:Myo10 APN 15 25726488 missense probably benign 0.03
IGL02307:Myo10 APN 15 25776315 splice site probably benign
IGL02511:Myo10 APN 15 25723889 missense probably damaging 0.97
IGL03240:Myo10 APN 15 25701602 missense probably damaging 1.00
least UTSW 15 25726475 nonsense probably null
R0037:Myo10 UTSW 15 25666532 intron probably benign
R0153:Myo10 UTSW 15 25781238 missense possibly damaging 0.84
R0282:Myo10 UTSW 15 25793167 missense probably damaging 1.00
R0360:Myo10 UTSW 15 25804368 missense probably damaging 1.00
R0585:Myo10 UTSW 15 25736455 missense probably damaging 1.00
R0617:Myo10 UTSW 15 25738005 missense probably damaging 1.00
R0729:Myo10 UTSW 15 25722157 splice site probably benign
R0771:Myo10 UTSW 15 25778178 missense probably damaging 1.00
R0960:Myo10 UTSW 15 25801189 missense probably damaging 1.00
R1562:Myo10 UTSW 15 25780411 missense possibly damaging 0.81
R1651:Myo10 UTSW 15 25742369 missense probably damaging 1.00
R1789:Myo10 UTSW 15 25726525 critical splice donor site probably null
R1816:Myo10 UTSW 15 25800200 missense probably damaging 1.00
R1835:Myo10 UTSW 15 25805587 missense possibly damaging 0.53
R1908:Myo10 UTSW 15 25801222 missense probably damaging 1.00
R2082:Myo10 UTSW 15 25785993 missense probably damaging 1.00
R2101:Myo10 UTSW 15 25722259 missense probably benign 0.26
R2129:Myo10 UTSW 15 25781799 missense probably benign 0.09
R2141:Myo10 UTSW 15 25714108 missense probably benign
R2142:Myo10 UTSW 15 25714108 missense probably benign
R2920:Myo10 UTSW 15 25801140 missense probably damaging 1.00
R2938:Myo10 UTSW 15 25795717 missense probably damaging 0.99
R3723:Myo10 UTSW 15 25803288 missense probably damaging 1.00
R3852:Myo10 UTSW 15 25779626 missense probably damaging 1.00
R4162:Myo10 UTSW 15 25726415 splice site probably null
R4163:Myo10 UTSW 15 25726415 splice site probably null
R4164:Myo10 UTSW 15 25726415 splice site probably null
R4177:Myo10 UTSW 15 25734051 missense possibly damaging 0.81
R4409:Myo10 UTSW 15 25807869 missense probably damaging 1.00
R4667:Myo10 UTSW 15 25793153 missense possibly damaging 0.91
R4905:Myo10 UTSW 15 25800212 missense probably damaging 0.99
R4933:Myo10 UTSW 15 25781118 missense probably damaging 0.96
R4968:Myo10 UTSW 15 25808184 missense probably damaging 1.00
R5081:Myo10 UTSW 15 25785940 missense probably damaging 1.00
R5123:Myo10 UTSW 15 25726483 missense possibly damaging 0.94
R5310:Myo10 UTSW 15 25778078 splice site probably null
R6073:Myo10 UTSW 15 25736642 missense probably damaging 1.00
R6117:Myo10 UTSW 15 25805659 missense probably benign 0.00
R6185:Myo10 UTSW 15 25726510 missense probably damaging 0.99
R6819:Myo10 UTSW 15 25781410 missense possibly damaging 0.80
R6875:Myo10 UTSW 15 25805659 missense probably benign 0.00
R6908:Myo10 UTSW 15 25804383 missense probably damaging 1.00
R6963:Myo10 UTSW 15 25734063 missense probably benign 0.31
R7144:Myo10 UTSW 15 25723925 missense probably damaging 1.00
R7266:Myo10 UTSW 15 25782981 missense probably damaging 1.00
R7380:Myo10 UTSW 15 25779620 missense probably benign 0.01
R7460:Myo10 UTSW 15 25807827 missense probably damaging 1.00
R7614:Myo10 UTSW 15 25701623 missense probably benign 0.00
R7618:Myo10 UTSW 15 25726475 nonsense probably null
R7717:Myo10 UTSW 15 25731970 missense probably benign 0.01
R7811:Myo10 UTSW 15 25804524 missense probably damaging 1.00
R7830:Myo10 UTSW 15 25737971 nonsense probably null
R7862:Myo10 UTSW 15 25666436 missense probably damaging 1.00
R8232:Myo10 UTSW 15 25804314 missense possibly damaging 0.89
R8264:Myo10 UTSW 15 25800109 missense probably damaging 0.99
R8377:Myo10 UTSW 15 25804395 missense possibly damaging 0.94
R8385:Myo10 UTSW 15 25804398 missense probably damaging 1.00
R8426:Myo10 UTSW 15 25799490 missense probably damaging 0.99
R8439:Myo10 UTSW 15 25725072 missense probably benign 0.00
R8696:Myo10 UTSW 15 25799486 missense probably damaging 1.00
R8775:Myo10 UTSW 15 25800059 missense probably damaging 0.97
R8775-TAIL:Myo10 UTSW 15 25800059 missense probably damaging 0.97
RF013:Myo10 UTSW 15 25799479 missense probably damaging 0.99
Z1177:Myo10 UTSW 15 25781401 missense probably damaging 1.00
Z1177:Myo10 UTSW 15 25799554 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCATTTCGCTGGATCGCTC -3'
(R):5'- AATCTGTCTGCAACTGAGCGC -3'

Sequencing Primer
(F):5'- CTGGATCGCTCCCGCCC -3'
(R):5'- GAGCGCTCTCCAGTGAATG -3'
Posted On2018-08-29