Incidental Mutation 'R6749:Vars2'
ID532913
Institutional Source Beutler Lab
Gene Symbol Vars2
Ensembl Gene ENSMUSG00000038838
Gene Namevalyl-tRNA synthetase 2, mitochondrial
SynonymsVars2l
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35655634-35667592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35666713 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 109 (V109A)
Ref Sequence ENSEMBL: ENSMUSP00000047917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001565] [ENSMUST00000043674] [ENSMUST00000160039] [ENSMUST00000160734] [ENSMUST00000160752] [ENSMUST00000162266] [ENSMUST00000165144] [ENSMUST00000169093]
Predicted Effect probably benign
Transcript: ENSMUST00000001565
SMART Domains Protein: ENSMUSP00000001565
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 6.4e-141 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000043674
AA Change: V109A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047917
Gene: ENSMUSG00000038838
AA Change: V109A

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 112 736 3.3e-179 PFAM
Pfam:tRNA-synt_1g 141 221 2e-8 PFAM
Pfam:Anticodon_1 780 932 3.6e-32 PFAM
low complexity region 1005 1015 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160039
SMART Domains Protein: ENSMUSP00000124683
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 164 2.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160734
SMART Domains Protein: ENSMUSP00000124335
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 1.9e-137 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160752
SMART Domains Protein: ENSMUSP00000124458
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 160 6.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162266
SMART Domains Protein: ENSMUSP00000124103
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 91 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164404
SMART Domains Protein: ENSMUSP00000126084
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 1 201 1e-49 PFAM
Pfam:tRNA-synt_1g 68 172 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165144
Predicted Effect probably benign
Transcript: ENSMUST00000168922
SMART Domains Protein: ENSMUSP00000129196
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 2 386 3e-105 PFAM
Pfam:Anticodon_1 430 566 8.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169093
SMART Domains Protein: ENSMUSP00000126794
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 1 109 1.7e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Vars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Vars2 APN 17 35664621 unclassified probably benign
IGL02320:Vars2 APN 17 35660454 missense probably benign 0.07
IGL02580:Vars2 APN 17 35660885 missense possibly damaging 0.50
IGL02691:Vars2 APN 17 35660248 missense probably damaging 1.00
IGL03039:Vars2 APN 17 35664121 missense probably damaging 1.00
PIT4445001:Vars2 UTSW 17 35666211 nonsense probably null
R0079:Vars2 UTSW 17 35659156 missense probably damaging 0.99
R0152:Vars2 UTSW 17 35660027 missense probably damaging 1.00
R0346:Vars2 UTSW 17 35664864 unclassified probably benign
R0426:Vars2 UTSW 17 35664584 missense probably damaging 1.00
R0584:Vars2 UTSW 17 35666686 missense possibly damaging 0.82
R0589:Vars2 UTSW 17 35659176 missense probably benign
R0882:Vars2 UTSW 17 35657299 missense probably benign 0.41
R1234:Vars2 UTSW 17 35667146 missense probably damaging 1.00
R1263:Vars2 UTSW 17 35661609 missense probably damaging 1.00
R1559:Vars2 UTSW 17 35666258 unclassified probably benign
R1772:Vars2 UTSW 17 35660084 missense probably damaging 1.00
R1809:Vars2 UTSW 17 35662216 missense probably damaging 1.00
R1913:Vars2 UTSW 17 35666922 missense probably benign 0.02
R1986:Vars2 UTSW 17 35660061 missense probably damaging 1.00
R2504:Vars2 UTSW 17 35664793 missense probably damaging 1.00
R3426:Vars2 UTSW 17 35661974 missense probably damaging 1.00
R4539:Vars2 UTSW 17 35666888 missense probably damaging 0.99
R4751:Vars2 UTSW 17 35659343 missense possibly damaging 0.89
R4861:Vars2 UTSW 17 35661933 missense probably benign 0.00
R4861:Vars2 UTSW 17 35661933 missense probably benign 0.00
R5028:Vars2 UTSW 17 35659473 critical splice donor site probably null
R5217:Vars2 UTSW 17 35658149 missense probably damaging 1.00
R5292:Vars2 UTSW 17 35660786 missense probably damaging 1.00
R6056:Vars2 UTSW 17 35665788 missense probably benign 0.01
R6211:Vars2 UTSW 17 35665662 unclassified probably null
R6213:Vars2 UTSW 17 35660440 missense probably benign 0.27
R6374:Vars2 UTSW 17 35660045 missense probably damaging 1.00
R6746:Vars2 UTSW 17 35660402 critical splice donor site probably null
R6957:Vars2 UTSW 17 35667075 missense probably benign 0.39
R7107:Vars2 UTSW 17 35658250 missense probably damaging 1.00
R7428:Vars2 UTSW 17 35666686 missense probably benign 0.00
R7538:Vars2 UTSW 17 35660780 missense probably damaging 1.00
R7553:Vars2 UTSW 17 35664788 missense possibly damaging 0.93
R7741:Vars2 UTSW 17 35660943 missense probably damaging 1.00
R7784:Vars2 UTSW 17 35658158 missense possibly damaging 0.95
R7823:Vars2 UTSW 17 35659136 missense probably damaging 1.00
R8201:Vars2 UTSW 17 35658310 missense probably benign
X0021:Vars2 UTSW 17 35659034 missense possibly damaging 0.93
Z1176:Vars2 UTSW 17 35664791 missense possibly damaging 0.55
Z1177:Vars2 UTSW 17 35663472 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TAGGGGAACAGCACCCTCT -3'
(R):5'- GGCCTGGAGTCACAAGGAG -3'

Sequencing Primer
(F):5'- TCGTCTACAGAGTTCCAGGAC -3'
(R):5'- GGTAGTATTGTATGAAATCCCCACCG -3'
Posted On2018-08-29