Mutagenetix > Incidental Mutation

Incidental Mutation 'R6749:Ptprs'

532914

Institutional Source

Beutler Lab

Gene Symbol

Ptprs

Ensembl Gene

ENSMUSG00000013236

Gene Name

protein tyrosine phosphatase, receptor type, S

Synonyms

Ptpt9, PTP-NU3, RPTPsigma, PTPsigma

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6749 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

56412426-56476483 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 56437884 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 284 (V284A)

Ref Sequence

ENSEMBL: ENSMUSP00000153134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067538] [ENSMUST00000086828] [ENSMUST00000223642] [ENSMUST00000223859] [ENSMUST00000225456]

AlphaFold

B0V2N1

Predicted Effect

probably damaging
Transcript: ENSMUST00000067538
AA Change: V284A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064048
Gene: ENSMUSG00000013236
AA Change: V284A

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
IGc2	45	114	3.38e-10	SMART
IGc2	147	214	2.4e-15	SMART
IGc2	244	305	8.26e-5	SMART
FN3	319	398	2.8e-14	SMART
FN3	414	497	3.24e-10	SMART
FN3	512	590	3.17e-13	SMART
FN3	605	692	9.69e-9	SMART
FN3	707	796	2.42e-9	SMART
FN3	811	890	2.22e0	SMART
FN3	905	995	8.31e-8	SMART
FN3	1009	1085	3.22e-5	SMART
low complexity region	1164	1177	N/A	INTRINSIC
transmembrane domain	1259	1281	N/A	INTRINSIC
PTPc	1351	1609	1.54e-136	SMART
PTPc	1638	1900	3.12e-128	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000086828
AA Change: V284A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084038
Gene: ENSMUSG00000013236
AA Change: V284A

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
IGc2	45	114	3.38e-10	SMART
IGc2	147	214	2.4e-15	SMART
IGc2	244	305	8.26e-5	SMART
FN3	319	398	2.8e-14	SMART
FN3	414	497	3.24e-10	SMART
FN3	512	590	3.17e-13	SMART
FN3	603	679	2.54e-3	SMART
low complexity region	758	771	N/A	INTRINSIC
transmembrane domain	853	875	N/A	INTRINSIC
PTPc	945	1203	1.54e-136	SMART
PTPc	1232	1494	3.12e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143018

Predicted Effect

probably benign
Transcript: ENSMUST00000223642

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223671

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223691

Predicted Effect

probably damaging
Transcript: ENSMUST00000223859
AA Change: V284A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000225456

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225785

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Almost half of null homozygotes die in the first day of life. Embryos are characterized by decreased brain size including small pituitary glands and small olfactory bulbs. Adult mice are small, lack estrus, have decreased litter sizes and have impairedolfaction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	G	11: 120,010,774	V875A	possibly damaging	Het
Arhgef15	A	T	11: 68,954,557	F156L	probably damaging	Het
Bdh2	T	A	3: 135,300,691	S184T	probably damaging	Het
Bmp5	A	T	9: 75,776,093	M1L	probably benign	Het
Cacfd1	T	C	2: 27,018,455	Y134H	probably damaging	Het
Camk1	G	A	6: 113,334,525	P340L	probably benign	Het
Ccdc105	A	C	10: 78,752,838	M46R	possibly damaging	Het
Cdc14a	T	C	3: 116,297,158	H424R	possibly damaging	Het
Cntfr	T	A	4: 41,663,232	T192S	possibly damaging	Het
Erbin	G	T	13: 103,834,377	S910R	probably damaging	Het
Esrp1	A	T	4: 11,357,519	V366E	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fsip2	T	A	2: 82,978,394	S1686T	possibly damaging	Het
Gata5	A	G	2: 180,334,350	L7S	probably damaging	Het
Hgf	T	A	5: 16,613,642		probably null	Het
Ift140	A	G	17: 25,098,916	E1458G	probably damaging	Het
Ift57	G	A	16: 49,760,984	G209R	probably benign	Het
Il12rb2	G	T	6: 67,361,966		probably benign	Het
Krt78	G	A	15: 101,950,923	R280C	probably damaging	Het
Lipc	A	G	9: 70,823,386	I88T	probably damaging	Het
Lrmda	G	T	14: 22,027,276	R27L	probably benign	Het
Lrrc37a	T	G	11: 103,502,097	E834A	probably benign	Het
Mmachc	C	A	4: 116,704,541	R132L	probably damaging	Het
Myo10	T	C	15: 25,714,110	Y88H	probably damaging	Het
Myo5b	G	A	18: 74,701,503	R878Q	possibly damaging	Het
Olfr1392	A	G	11: 49,294,050	H243R	probably damaging	Het
Padi3	T	C	4: 140,795,853	T289A	possibly damaging	Het
Pcdhgb4	G	T	18: 37,721,229	A226S	possibly damaging	Het
Pde4c	T	C	8: 70,746,010	V167A	probably damaging	Het
Pigr	A	G	1: 130,846,548	T422A	probably benign	Het
Pmp2	T	C	3: 10,182,482	Y49C	probably benign	Het
Prpf39	A	G	12: 65,056,274	I441V	possibly damaging	Het
Rsad1	T	C	11: 94,543,340	E354G	probably damaging	Het
Sema4b	T	A	7: 80,220,201	D412E	possibly damaging	Het
Siglecg	A	G	7: 43,408,979	I97V	probably benign	Het
Slc4a3	C	T	1: 75,554,538	R792*	probably null	Het
Slc6a20a	A	G	9: 123,637,070	C569R	probably damaging	Het
Spata19	T	C	9: 27,397,980	V59A	probably benign	Het
Sult2a3	T	A	7: 14,082,704	Y183F	probably benign	Het
Tedc1	C	T	12: 113,158,082	T194M	probably damaging	Het
Tmem63c	T	A	12: 87,075,665	N412K	probably damaging	Het
Trav5-1	T	C	14: 52,622,945	I69T	possibly damaging	Het
Trim68	T	C	7: 102,678,783	D321G	probably damaging	Het
Ttn	T	C	2: 76,865,256		probably benign	Het
Vars2	A	G	17: 35,666,713	V109A	probably damaging	Het
Vmn2r96	C	T	17: 18,598,090	P643L	probably damaging	Het
Zfpm2	G	T	15: 40,954,708	V146F	possibly damaging	Het
Znfx1	T	C	2: 167,056,599	K135R	probably benign	Het

Other mutations in Ptprs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Ptprs	APN	17	56458243	missense	probably damaging	0.99
IGL01388:Ptprs	APN	17	56421261	missense	probably damaging	1.00
IGL01568:Ptprs	APN	17	56413958	missense	probably damaging	1.00
IGL01781:Ptprs	APN	17	56435676	missense	probably damaging	1.00
IGL02499:Ptprs	APN	17	56437884	missense	probably damaging	1.00
IGL02576:Ptprs	APN	17	56414958	missense	probably damaging	1.00
IGL02736:Ptprs	APN	17	56458248	missense	possibly damaging	0.88
IGL02871:Ptprs	APN	17	56447443	missense	probably damaging	1.00
IGL02946:Ptprs	APN	17	56424032	missense	probably benign
IGL03061:Ptprs	APN	17	56418830	missense	probably damaging	0.96
IGL03347:Ptprs	APN	17	56435972	missense	probably benign	0.07
IGL03351:Ptprs	APN	17	56437943	missense	probably damaging	1.00
P0019:Ptprs	UTSW	17	56447474	splice site	probably benign
PIT4434001:Ptprs	UTSW	17	56454984	missense	probably null	0.02
PIT4520001:Ptprs	UTSW	17	56414980	missense	probably damaging	1.00
R0240:Ptprs	UTSW	17	56436087	splice site	probably null
R0240:Ptprs	UTSW	17	56436087	splice site	probably null
R0504:Ptprs	UTSW	17	56454220	missense	possibly damaging	0.60
R0518:Ptprs	UTSW	17	56419621	critical splice donor site	probably null
R0539:Ptprs	UTSW	17	56458255	missense	probably damaging	0.97
R0620:Ptprs	UTSW	17	56429103	missense	possibly damaging	0.93
R0683:Ptprs	UTSW	17	56414086	missense	probably damaging	1.00
R1147:Ptprs	UTSW	17	56423504	missense	probably damaging	1.00
R1147:Ptprs	UTSW	17	56423504	missense	probably damaging	1.00
R1474:Ptprs	UTSW	17	56424128	missense	probably damaging	0.98
R1502:Ptprs	UTSW	17	56437992	missense	probably benign	0.00
R1817:Ptprs	UTSW	17	56419527	missense	probably damaging	1.00
R1844:Ptprs	UTSW	17	56434510	missense	probably damaging	1.00
R2077:Ptprs	UTSW	17	56434990	missense	probably null	0.26
R2086:Ptprs	UTSW	17	56454984	missense	probably null	0.02
R2149:Ptprs	UTSW	17	56417706	missense	probably damaging	1.00
R3618:Ptprs	UTSW	17	56428965	missense	probably benign	0.25
R3722:Ptprs	UTSW	17	56417485	missense	probably damaging	1.00
R3771:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R3772:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R3773:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R4032:Ptprs	UTSW	17	56413386	missense	probably damaging	1.00
R4326:Ptprs	UTSW	17	56447468	missense	possibly damaging	0.83
R4327:Ptprs	UTSW	17	56447468	missense	possibly damaging	0.83
R4480:Ptprs	UTSW	17	56426404	missense	possibly damaging	0.79
R4505:Ptprs	UTSW	17	56451678	missense	possibly damaging	0.57
R4507:Ptprs	UTSW	17	56419014	missense	probably damaging	1.00
R4588:Ptprs	UTSW	17	56425534	missense	probably damaging	1.00
R4662:Ptprs	UTSW	17	56417666	missense	probably damaging	1.00
R4708:Ptprs	UTSW	17	56428067	missense	probably damaging	1.00
R5016:Ptprs	UTSW	17	56419070	missense	probably damaging	1.00
R5416:Ptprs	UTSW	17	56435724	missense	probably damaging	1.00
R5447:Ptprs	UTSW	17	56429128	missense	possibly damaging	0.50
R6041:Ptprs	UTSW	17	56419080	missense	probably benign	0.00
R6329:Ptprs	UTSW	17	56417427	nonsense	probably null
R6377:Ptprs	UTSW	17	56418935	missense	probably damaging	1.00
R6605:Ptprs	UTSW	17	56422195	missense	probably damaging	1.00
R7113:Ptprs	UTSW	17	56451697	missense	probably benign	0.40
R7114:Ptprs	UTSW	17	56451697	missense	probably benign	0.40
R7133:Ptprs	UTSW	17	56417429	missense	probably damaging	1.00
R7220:Ptprs	UTSW	17	56418988	missense	probably benign	0.29
R7423:Ptprs	UTSW	17	56414793	missense	probably damaging	1.00
R7440:Ptprs	UTSW	17	56424256	missense	possibly damaging	0.75
R7457:Ptprs	UTSW	17	56419502	missense	probably damaging	0.99
R7574:Ptprs	UTSW	17	56423538	missense	probably benign	0.00
R7851:Ptprs	UTSW	17	56425482	missense	probably benign
R7903:Ptprs	UTSW	17	56424960	nonsense	probably null
R8013:Ptprs	UTSW	17	56435994	missense	probably damaging	1.00
R8014:Ptprs	UTSW	17	56435994	missense	probably damaging	1.00
R8094:Ptprs	UTSW	17	56428947	missense	probably benign	0.01
R8112:Ptprs	UTSW	17	56434532	nonsense	probably null
R8181:Ptprs	UTSW	17	56429064	missense	probably damaging	1.00
R8511:Ptprs	UTSW	17	56447440	missense	probably damaging	1.00
R8682:Ptprs	UTSW	17	56435849	missense	probably damaging	0.98
R8875:Ptprs	UTSW	17	56435946	missense	probably damaging	1.00
R8911:Ptprs	UTSW	17	56423320	missense	probably benign	0.07
R8970:Ptprs	UTSW	17	56423353	missense	possibly damaging	0.94
R9117:Ptprs	UTSW	17	56435853	missense	possibly damaging	0.84
R9297:Ptprs	UTSW	17	56458257	missense	probably damaging	0.96
R9539:Ptprs	UTSW	17	56418715	missense	probably benign	0.09
R9803:Ptprs	UTSW	17	56422217	missense	probably damaging	1.00
RF014:Ptprs	UTSW	17	56416935	missense	probably damaging	1.00
X0028:Ptprs	UTSW	17	56437831	missense	probably damaging	1.00
Z1176:Ptprs	UTSW	17	56417050	missense	possibly damaging	0.82
Z1176:Ptprs	UTSW	17	56422211	nonsense	probably null
Z1176:Ptprs	UTSW	17	56434468	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- TGGCTACACCCACTTCCTAG -3'
(R):5'- TGTGAAGTTCCTGCCTTTGAAG -3'

Sequencing Primer
(F):5'- AGCTCTGCCTATGCCTGCAC -3'
(R):5'- GAAGTTCCTGCCTTTGAAGTTTCC -3'

Posted On

2018-08-29