Incidental Mutation 'R6749:Myo5b'
ID532916
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Namemyosin VB
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.750) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location74440936-74771493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74701503 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 878 (R878Q)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074157
AA Change: R878Q

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: R878Q

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121875
AA Change: R878Q

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: R878Q

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
unrat UTSW 18 74653361 missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74731754 missense probably benign
BB017:Myo5b UTSW 18 74731754 missense probably benign
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0114:Myo5b UTSW 18 74742171 missense probably benign 0.03
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4516:Myo5b UTSW 18 74625674 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74638153 critical splice donor site probably null
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74742175 missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 synonymous probably null
R6088:Myo5b UTSW 18 74720898 missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74700679 missense probably benign 0.19
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6330:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74701528 missense probably benign 0.01
R7162:Myo5b UTSW 18 74695427 missense probably benign 0.02
R7345:Myo5b UTSW 18 74708024 missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74731731 missense probably benign 0.00
R7564:Myo5b UTSW 18 74634511 missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74627254 critical splice donor site probably null
R7635:Myo5b UTSW 18 74580396 missense probably damaging 1.00
R7670:Myo5b UTSW 18 74701446 missense probably benign 0.05
R7754:Myo5b UTSW 18 74634559 missense probably benign 0.02
R7930:Myo5b UTSW 18 74731754 missense probably benign
R8013:Myo5b UTSW 18 74760899 nonsense probably null
R8271:Myo5b UTSW 18 74627190 missense probably damaging 1.00
R8312:Myo5b UTSW 18 74733962 missense probably damaging 1.00
RF009:Myo5b UTSW 18 74643999 missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Z1177:Myo5b UTSW 18 74617017 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCCACATATGCATGGTCTCC -3'
(R):5'- AGCTTCGACACCCATGTAGG -3'

Sequencing Primer
(F):5'- TATGCATGGTCTCCTAAACCCAAGG -3'
(R):5'- TTCGACACCCATGTAGGAGACTC -3'
Posted On2018-08-29