Mutagenetix > Incidental Mutation

Incidental Mutation 'R6789:Aox2'

532917

Institutional Source

Beutler Lab

Gene Symbol

Aox2

Ensembl Gene

ENSMUSG00000079554

Gene Name

aldehyde oxidase 2

Synonyms

Aox3l1

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R6789 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

58278326-58380259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58304485 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 442 (D442E)

Ref Sequence

ENSEMBL: ENSMUSP00000110006 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114366]

AlphaFold

Q5SGK3

Predicted Effect

probably benign
Transcript: ENSMUST00000114366
AA Change: D442E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: D442E

Domain	Start	End	E-Value	Type
Pfam:Fer2	13	83	3.4e-9	PFAM
Pfam:Fer2_2	92	166	4.2e-30	PFAM
Pfam:FAD_binding_5	241	421	5.1e-46	PFAM
CO_deh_flav_C	428	532	1.4e-23	SMART
Ald_Xan_dh_C	604	707	4.64e-47	SMART
Pfam:Ald_Xan_dh_C2	717	1251	1.3e-178	PFAM
low complexity region	1257	1271	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arl6ip4	G	A	5: 124,116,602	G53R	probably damaging	Het
Asns	T	C	6: 7,675,344	T553A	probably benign	Het
Atp1a1	T	A	3: 101,586,298	N497Y	possibly damaging	Het
BC005561	T	C	5: 104,517,689	F26L	probably benign	Het
Birc2	T	C	9: 7,836,965		probably benign	Het
Catsperd	C	A	17: 56,654,426		probably null	Het
Dchs1	G	T	7: 105,757,003	Q2341K	possibly damaging	Het
Dydc2	C	A	14: 41,049,339	V128L	probably benign	Het
Efna3	C	T	3: 89,316,462		probably null	Het
Fam160a1	A	T	3: 85,672,558	L780*	probably null	Het
Fbn2	C	T	18: 58,010,614	E2790K	probably benign	Het
Gm11569	C	A	11: 99,798,831		probably benign	Het
Gprc6a	C	T	10: 51,631,316	G39D	probably damaging	Het
Igkv6-17	A	G	6: 70,371,708	D21G	probably benign	Het
Klra4	T	C	6: 130,062,219	Q70R	probably damaging	Het
Krtap31-2	C	T	11: 99,936,723	S127F	possibly damaging	Het
Lingo4	G	T	3: 94,399,355		probably benign	Het
Lrp2bp	A	G	8: 46,013,114	K87E	possibly damaging	Het
Macf1	A	T	4: 123,372,438	M5333K	probably damaging	Het
Mmp13	A	T	9: 7,272,781	Y47F	probably benign	Het
Muc16	G	A	9: 18,559,986	P7261S	probably benign	Het
Nostrin	G	T	2: 69,175,512	M212I	probably benign	Het
Nr1h5	G	A	3: 102,958,361	T8M	possibly damaging	Het
Nup153	A	T	13: 46,717,316	L41H	probably damaging	Het
Olfr1358	T	C	10: 78,519,968	L120P	noncoding transcript	Het
Olfr1447	T	A	19: 12,901,289	I164L	probably benign	Het
Pappa	A	T	4: 65,181,041	D599V	probably damaging	Het
Pcdh18	G	A	3: 49,755,915	T317I	probably benign	Het
Pcsk5	T	A	19: 17,456,786	N1406I	possibly damaging	Het
Pik3c2a	A	T	7: 116,362,184	Y1027N	probably damaging	Het
Prpf6	T	A	2: 181,616,051	Y105*	probably null	Het
Rab5a	C	T	17: 53,497,622	P87S	probably damaging	Het
Rnf8	T	A	17: 29,635,869	W433R	probably damaging	Het
Slc18b1	T	A	10: 23,816,329	V232D	probably benign	Het
Taf11	C	A	17: 27,907,518	A52S	probably benign	Het
Trav9-2	T	C	14: 53,591,362	L63P	possibly damaging	Het
Wdr34	A	G	2: 30,033,272		probably null	Het
Zfat	T	C	15: 68,084,386	Y1199C	probably damaging	Het

Other mutations in Aox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Aox2	APN	1	58322801	missense	possibly damaging	0.73
IGL01288:Aox2	APN	1	58294407	missense	probably damaging	0.99
IGL01383:Aox2	APN	1	58294305	missense	probably benign	0.09
IGL01734:Aox2	APN	1	58354310	missense	possibly damaging	0.95
IGL01793:Aox2	APN	1	58336624	missense	possibly damaging	0.79
IGL01834:Aox2	APN	1	58309024	missense	possibly damaging	0.90
IGL01924:Aox2	APN	1	58287743	missense	possibly damaging	0.90
IGL02591:Aox2	APN	1	58358999	nonsense	probably null
IGL02645:Aox2	APN	1	58334724	missense	probably damaging	1.00
IGL02710:Aox2	APN	1	58334769	critical splice donor site	probably null
IGL02801:Aox2	APN	1	58354177	missense	probably damaging	1.00
IGL02988:Aox2	APN	1	58337350	missense	probably benign
IGL03104:Aox2	APN	1	58282759	missense	probably benign
IGL03121:Aox2	APN	1	58358954	missense	probably damaging	1.00
IGL03191:Aox2	APN	1	58359069	missense	probably null	0.98
IGL03236:Aox2	APN	1	58309997	nonsense	probably null
IGL03409:Aox2	APN	1	58354429	missense	possibly damaging	0.91
PIT4362001:Aox2	UTSW	1	58282680	missense	probably damaging	1.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0267:Aox2	UTSW	1	58339446	splice site	probably benign
R0388:Aox2	UTSW	1	58354406	missense	probably damaging	1.00
R0409:Aox2	UTSW	1	58336624	missense	possibly damaging	0.90
R0547:Aox2	UTSW	1	58310042	missense	probably damaging	0.96
R0630:Aox2	UTSW	1	58337321	splice site	probably benign
R0726:Aox2	UTSW	1	58334782	splice site	probably benign
R0734:Aox2	UTSW	1	58305341	missense	probably benign	0.22
R0831:Aox2	UTSW	1	58339683	missense	probably benign	0.28
R0961:Aox2	UTSW	1	58310071	missense	probably benign	0.00
R1404:Aox2	UTSW	1	58346212	splice site	probably benign
R1512:Aox2	UTSW	1	58307351	missense	probably benign	0.00
R1573:Aox2	UTSW	1	58309027	missense	probably benign	0.00
R1592:Aox2	UTSW	1	58300694	missense	probably benign	0.00
R1747:Aox2	UTSW	1	58339592	missense	probably benign	0.01
R1768:Aox2	UTSW	1	58354195	missense	probably benign	0.00
R1809:Aox2	UTSW	1	58294325	missense	probably benign
R1823:Aox2	UTSW	1	58312359	missense	probably benign	0.02
R1834:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1835:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1836:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R2219:Aox2	UTSW	1	58349130	splice site	probably null
R2220:Aox2	UTSW	1	58349130	splice site	probably null
R2508:Aox2	UTSW	1	58343673	missense	probably benign	0.38
R2942:Aox2	UTSW	1	58337381	missense	probably benign	0.03
R2967:Aox2	UTSW	1	58322834	missense	probably damaging	0.96
R3082:Aox2	UTSW	1	58283600	splice site	probably benign
R3161:Aox2	UTSW	1	58304438	missense	possibly damaging	0.91
R3408:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R3803:Aox2	UTSW	1	58289899	splice site	probably null
R3894:Aox2	UTSW	1	58334678	critical splice acceptor site	probably null
R4214:Aox2	UTSW	1	58307444	critical splice donor site	probably null
R4249:Aox2	UTSW	1	58299819	missense	probably benign	0.01
R4666:Aox2	UTSW	1	58304597	nonsense	probably null
R4668:Aox2	UTSW	1	58334694	missense	possibly damaging	0.63
R4703:Aox2	UTSW	1	58358957	missense	possibly damaging	0.78
R4758:Aox2	UTSW	1	58332582	missense	probably benign	0.00
R4890:Aox2	UTSW	1	58334703	missense	probably benign	0.11
R4900:Aox2	UTSW	1	58305385	missense	probably benign
R4924:Aox2	UTSW	1	58305344	missense	probably damaging	1.00
R4970:Aox2	UTSW	1	58310095	splice site	probably null
R5112:Aox2	UTSW	1	58310095	splice site	probably null
R5987:Aox2	UTSW	1	58307359	missense	probably benign	0.00
R6239:Aox2	UTSW	1	58305391	critical splice donor site	probably null
R6273:Aox2	UTSW	1	58339672	missense	probably benign	0.00
R6291:Aox2	UTSW	1	58330806	missense	probably damaging	0.98
R6334:Aox2	UTSW	1	58307407	nonsense	probably null
R6764:Aox2	UTSW	1	58350282	missense	probably damaging	0.97
R6766:Aox2	UTSW	1	58349068	missense	possibly damaging	0.95
R6804:Aox2	UTSW	1	58304598	missense	probably benign	0.04
R7007:Aox2	UTSW	1	58330892	missense	probably damaging	1.00
R7015:Aox2	UTSW	1	58282758	missense	probably benign	0.00
R7055:Aox2	UTSW	1	58299768	missense	probably benign	0.08
R7089:Aox2	UTSW	1	58336649	missense	probably benign	0.01
R7157:Aox2	UTSW	1	58283492	missense	probably benign	0.00
R7303:Aox2	UTSW	1	58334765	nonsense	probably null
R7426:Aox2	UTSW	1	58289983	nonsense	probably null
R7762:Aox2	UTSW	1	58349104	missense	probably damaging	1.00
R7899:Aox2	UTSW	1	58281237	splice site	probably null
R7942:Aox2	UTSW	1	58337431	missense	probably damaging	1.00
R7975:Aox2	UTSW	1	58309028	missense	probably benign	0.02
R8029:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R8032:Aox2	UTSW	1	58350283	missense	probably benign	0.01
R8147:Aox2	UTSW	1	58300662	missense	probably benign	0.02
R8165:Aox2	UTSW	1	58308929	missense	probably benign	0.08
R8326:Aox2	UTSW	1	58295887	missense	probably benign
R8770:Aox2	UTSW	1	58339604	missense	probably benign	0.10
R8973:Aox2	UTSW	1	58289954	missense	probably benign	0.34
R9015:Aox2	UTSW	1	58343692	missense	probably damaging	1.00
R9097:Aox2	UTSW	1	58287728	missense	possibly damaging	0.82
R9101:Aox2	UTSW	1	58332637	missense	probably benign	0.03
R9108:Aox2	UTSW	1	58282692	missense	probably damaging	1.00
R9180:Aox2	UTSW	1	58339618	nonsense	probably null
R9258:Aox2	UTSW	1	58312356	missense	probably damaging	1.00
R9293:Aox2	UTSW	1	58322794	missense	possibly damaging	0.86
R9519:Aox2	UTSW	1	58334767	missense	probably damaging	0.98
R9581:Aox2	UTSW	1	58330896	critical splice donor site	probably null
Z1177:Aox2	UTSW	1	58354397	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- AACTTTGGCATGCAAAGGTAG -3'
(R):5'- TGTCAGGGCCAATTCTTTGTC -3'

Sequencing Primer
(F):5'- CTTTGGCATGCAAAGGTAGCAGATAG -3'
(R):5'- GGCCAATTCTTTGTCCTGTCATTGAG -3'

Posted On

2018-08-29