Mutagenetix > Incidental Mutations

Incidental Mutation 'R6789:Nostrin'

532919

Institutional Source

Beutler Lab

Gene Symbol

Nostrin

Ensembl Gene

ENSMUSG00000034738

Gene Name

nitric oxide synthase trafficker

Synonyms

mDaIP2

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.358) question?

Stock #

R6789 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

69135800-69189330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 69175512 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 212 (M212I)

Ref Sequence

ENSEMBL: ENSMUSP00000036923 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041865]

Predicted Effect

probably benign
Transcript: ENSMUST00000041865
AA Change: M212I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000036923
Gene: ENSMUSG00000034738
AA Change: M212I

Domain	Start	End	E-Value	Type
Pfam:FCH	13	88	4.9e-12	PFAM
low complexity region	135	146	N/A	INTRINSIC
coiled coil region	160	190	N/A	INTRINSIC
coiled coil region	305	334	N/A	INTRINSIC
low complexity region	419	439	N/A	INTRINSIC
SH3	441	496	8.89e-23	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide (NO) is a potent mediator in biologic processes such as neurotransmission, inflammatory response, and vascular homeostasis. NOSTRIN binds the enzyme responsible for NO production, endothelial NO synthase (ENOS; MIM 163729), and triggers the translocation of ENOS from the plasma membrane to vesicle-like subcellular structures, thereby attenuating ENOS-dependent NO production.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired retinal vascular angiogenesis, endothelial cell proliferation, endothelial cell migration and induced neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox2	T	A	1: 58,304,485	D442E	probably benign	Het
Arl6ip4	G	A	5: 124,116,602	G53R	probably damaging	Het
Asns	T	C	6: 7,675,344	T553A	probably benign	Het
Atp1a1	T	A	3: 101,586,298	N497Y	possibly damaging	Het
BC005561	T	C	5: 104,517,689	F26L	probably benign	Het
Birc2	T	C	9: 7,836,965		probably benign	Het
Catsperd	C	A	17: 56,654,426		probably null	Het
Dchs1	G	T	7: 105,757,003	Q2341K	possibly damaging	Het
Dydc2	C	A	14: 41,049,339	V128L	probably benign	Het
Efna3	C	T	3: 89,316,462		probably null	Het
Fam160a1	A	T	3: 85,672,558	L780*	probably null	Het
Fbn2	C	T	18: 58,010,614	E2790K	probably benign	Het
Gm11569	C	A	11: 99,798,831		probably benign	Het
Gprc6a	C	T	10: 51,631,316	G39D	probably damaging	Het
Igkv6-17	A	G	6: 70,371,708	D21G	probably benign	Het
Klra4	T	C	6: 130,062,219	Q70R	probably damaging	Het
Krtap31-2	C	T	11: 99,936,723	S127F	possibly damaging	Het
Lingo4	G	T	3: 94,399,355		probably benign	Het
Lrp2bp	A	G	8: 46,013,114	K87E	possibly damaging	Het
Macf1	A	T	4: 123,372,438	M5333K	probably damaging	Het
Mmp13	A	T	9: 7,272,781	Y47F	probably benign	Het
Muc16	G	A	9: 18,559,986	P7261S	probably benign	Het
Nr1h5	G	A	3: 102,958,361	T8M	possibly damaging	Het
Nup153	A	T	13: 46,717,316	L41H	probably damaging	Het
Olfr1358	T	C	10: 78,519,968	L120P	noncoding transcript	Het
Olfr1447	T	A	19: 12,901,289	I164L	probably benign	Het
Pappa	A	T	4: 65,181,041	D599V	probably damaging	Het
Pcdh18	G	A	3: 49,755,915	T317I	probably benign	Het
Pcsk5	T	A	19: 17,456,786	N1406I	possibly damaging	Het
Pik3c2a	A	T	7: 116,362,184	Y1027N	probably damaging	Het
Prpf6	T	A	2: 181,616,051	Y105*	probably null	Het
Rab5a	C	T	17: 53,497,622	P87S	probably damaging	Het
Rnf8	T	A	17: 29,635,869	W433R	probably damaging	Het
Slc18b1	T	A	10: 23,816,329	V232D	probably benign	Het
Taf11	C	A	17: 27,907,518	A52S	probably benign	Het
Trav9-2	T	C	14: 53,591,362	L63P	possibly damaging	Het
Wdr34	A	G	2: 30,033,272		probably null	Het
Zfat	T	C	15: 68,084,386	Y1199C	probably damaging	Het

Other mutations in Nostrin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Nostrin	APN	2	69185554	splice site	probably benign
IGL00502:Nostrin	APN	2	69183992	missense	probably benign
IGL00767:Nostrin	APN	2	69175775	missense	probably benign	0.00
IGL00846:Nostrin	APN	2	69185555	splice site	probably benign
IGL00912:Nostrin	APN	2	69182819	splice site	probably benign
IGL02123:Nostrin	APN	2	69156109	splice site	probably benign
IGL02213:Nostrin	APN	2	69183918	missense	probably benign	0.25
R0295:Nostrin	UTSW	2	69179416	missense	probably benign	0.19
R0543:Nostrin	UTSW	2	69189131	makesense	probably null
R1384:Nostrin	UTSW	2	69189062	missense	probably benign	0.05
R1501:Nostrin	UTSW	2	69158785	missense	probably damaging	1.00
R1632:Nostrin	UTSW	2	69175734	missense	probably benign	0.21
R2012:Nostrin	UTSW	2	69144767	splice site	probably null
R2140:Nostrin	UTSW	2	69166003	missense	probably damaging	0.98
R2159:Nostrin	UTSW	2	69180922	splice site	probably null
R2329:Nostrin	UTSW	2	69161094	missense	probably damaging	1.00
R2890:Nostrin	UTSW	2	69180905	missense	probably benign
R4469:Nostrin	UTSW	2	69175717	missense	probably damaging	0.99
R4607:Nostrin	UTSW	2	69183899	missense	possibly damaging	0.89
R4608:Nostrin	UTSW	2	69183899	missense	possibly damaging	0.89
R4684:Nostrin	UTSW	2	69183924	missense	probably benign	0.00
R4719:Nostrin	UTSW	2	69144812	nonsense	probably null
R4846:Nostrin	UTSW	2	69175579	missense	probably damaging	1.00
R4911:Nostrin	UTSW	2	69161142	missense	possibly damaging	0.87
R4987:Nostrin	UTSW	2	69156431	missense	probably benign
R5054:Nostrin	UTSW	2	69175713	missense	possibly damaging	0.82
R5177:Nostrin	UTSW	2	69175754	missense	possibly damaging	0.83
R6561:Nostrin	UTSW	2	69180857	missense	probably benign
R6785:Nostrin	UTSW	2	69183927	missense	probably benign	0.01
R7453:Nostrin	UTSW	2	69183896	missense	possibly damaging	0.95
R7465:Nostrin	UTSW	2	69185507	missense	possibly damaging	0.93
R7570:Nostrin	UTSW	2	69175806	missense	probably damaging	0.98
R7761:Nostrin	UTSW	2	69161122	missense	possibly damaging	0.88
R7802:Nostrin	UTSW	2	69189012	missense	probably benign	0.18
R8115:Nostrin	UTSW	2	69180920	critical splice donor site	probably null
R8160:Nostrin	UTSW	2	69179466	missense	probably damaging	0.98
X0021:Nostrin	UTSW	2	69144792	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATCTGCCTACATGCTGTG -3'
(R):5'- TGCAGTTTCTTCCATTAGAGCC -3'

Sequencing Primer
(F):5'- TCACAGGGAAGCTTGTGAGTTAAAG -3'
(R):5'- TGTGTGGCACTGGAACAC -3'

Posted On

2018-08-29