Incidental Mutation 'R6789:Fam160a1'
ID532922
Institutional Source Beutler Lab
Gene Symbol Fam160a1
Ensembl Gene ENSMUSG00000051000
Gene Namefamily with sequence similarity 160, member A1
Synonyms9930021J17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6789 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location85660061-85817291 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 85672558 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 780 (L780*)
Ref Sequence ENSEMBL: ENSMUSP00000113235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094148] [ENSMUST00000118408] [ENSMUST00000119077] [ENSMUST00000154148]
Predicted Effect probably null
Transcript: ENSMUST00000094148
AA Change: L780*
SMART Domains Protein: ENSMUSP00000091700
Gene: ENSMUSG00000051000
AA Change: L780*

DomainStartEndE-ValueType
Pfam:RAI16-like 88 411 1.2e-102 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118408
AA Change: L780*
SMART Domains Protein: ENSMUSP00000113235
Gene: ENSMUSG00000051000
AA Change: L780*

DomainStartEndE-ValueType
Pfam:RAI16-like 88 411 1.1e-98 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119077
SMART Domains Protein: ENSMUSP00000112705
Gene: ENSMUSG00000051000

DomainStartEndE-ValueType
low complexity region 67 84 N/A INTRINSIC
low complexity region 197 206 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox2 T A 1: 58,304,485 D442E probably benign Het
Arl6ip4 G A 5: 124,116,602 G53R probably damaging Het
Asns T C 6: 7,675,344 T553A probably benign Het
Atp1a1 T A 3: 101,586,298 N497Y possibly damaging Het
BC005561 T C 5: 104,517,689 F26L probably benign Het
Birc2 T C 9: 7,836,965 probably benign Het
Catsperd C A 17: 56,654,426 probably null Het
Dchs1 G T 7: 105,757,003 Q2341K possibly damaging Het
Dydc2 C A 14: 41,049,339 V128L probably benign Het
Efna3 C T 3: 89,316,462 probably null Het
Fbn2 C T 18: 58,010,614 E2790K probably benign Het
Gm11569 C A 11: 99,798,831 probably benign Het
Gprc6a C T 10: 51,631,316 G39D probably damaging Het
Igkv6-17 A G 6: 70,371,708 D21G probably benign Het
Klra4 T C 6: 130,062,219 Q70R probably damaging Het
Krtap31-2 C T 11: 99,936,723 S127F possibly damaging Het
Lingo4 G T 3: 94,399,355 probably benign Het
Lrp2bp A G 8: 46,013,114 K87E possibly damaging Het
Macf1 A T 4: 123,372,438 M5333K probably damaging Het
Mmp13 A T 9: 7,272,781 Y47F probably benign Het
Muc16 G A 9: 18,559,986 P7261S probably benign Het
Nostrin G T 2: 69,175,512 M212I probably benign Het
Nr1h5 G A 3: 102,958,361 T8M possibly damaging Het
Nup153 A T 13: 46,717,316 L41H probably damaging Het
Olfr1358 T C 10: 78,519,968 L120P noncoding transcript Het
Olfr1447 T A 19: 12,901,289 I164L probably benign Het
Pappa A T 4: 65,181,041 D599V probably damaging Het
Pcdh18 G A 3: 49,755,915 T317I probably benign Het
Pcsk5 T A 19: 17,456,786 N1406I possibly damaging Het
Pik3c2a A T 7: 116,362,184 Y1027N probably damaging Het
Prpf6 T A 2: 181,616,051 Y105* probably null Het
Rab5a C T 17: 53,497,622 P87S probably damaging Het
Rnf8 T A 17: 29,635,869 W433R probably damaging Het
Slc18b1 T A 10: 23,816,329 V232D probably benign Het
Taf11 C A 17: 27,907,518 A52S probably benign Het
Trav9-2 T C 14: 53,591,362 L63P possibly damaging Het
Wdr34 A G 2: 30,033,272 probably null Het
Zfat T C 15: 68,084,386 Y1199C probably damaging Het
Other mutations in Fam160a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam160a1 APN 3 85672618 missense probably benign 0.01
IGL01102:Fam160a1 APN 3 85665501 intron probably benign
IGL01317:Fam160a1 APN 3 85672846 missense probably benign 0.01
IGL01759:Fam160a1 APN 3 85688447 missense probably damaging 1.00
IGL02007:Fam160a1 APN 3 85722445 missense probably damaging 1.00
IGL02037:Fam160a1 APN 3 85730632 missense probably damaging 0.99
IGL02163:Fam160a1 APN 3 85688552 missense possibly damaging 0.92
IGL02192:Fam160a1 APN 3 85673326 missense possibly damaging 0.82
IGL02617:Fam160a1 APN 3 85673037 missense probably benign 0.00
PIT4378001:Fam160a1 UTSW 3 85730551 missense probably damaging 1.00
PIT4520001:Fam160a1 UTSW 3 85672472 nonsense probably null
PIT4651001:Fam160a1 UTSW 3 85683641 missense probably damaging 1.00
R0590:Fam160a1 UTSW 3 85672376 missense probably benign 0.13
R0625:Fam160a1 UTSW 3 85730500 missense possibly damaging 0.84
R0648:Fam160a1 UTSW 3 85730614 missense probably damaging 1.00
R0931:Fam160a1 UTSW 3 85673243 missense probably benign
R0940:Fam160a1 UTSW 3 85665490 missense possibly damaging 0.92
R0941:Fam160a1 UTSW 3 85673059 missense probably benign 0.03
R1115:Fam160a1 UTSW 3 85722495 missense probably benign 0.02
R1161:Fam160a1 UTSW 3 85672468 missense probably damaging 0.96
R1460:Fam160a1 UTSW 3 85730876 missense probably damaging 1.00
R1503:Fam160a1 UTSW 3 85672477 missense possibly damaging 0.70
R1545:Fam160a1 UTSW 3 85665954 missense probably damaging 1.00
R1820:Fam160a1 UTSW 3 85665829 missense probably damaging 1.00
R1907:Fam160a1 UTSW 3 85672633 missense probably benign 0.00
R1911:Fam160a1 UTSW 3 85661218 missense probably benign 0.12
R1928:Fam160a1 UTSW 3 85688531 missense probably damaging 1.00
R2200:Fam160a1 UTSW 3 85730321 missense probably damaging 1.00
R2235:Fam160a1 UTSW 3 85661101 missense probably damaging 0.97
R2373:Fam160a1 UTSW 3 85676097 nonsense probably null
R3084:Fam160a1 UTSW 3 85665968 critical splice acceptor site probably null
R4125:Fam160a1 UTSW 3 85665383 missense possibly damaging 0.87
R4601:Fam160a1 UTSW 3 85741180 missense probably damaging 1.00
R4612:Fam160a1 UTSW 3 85730372 nonsense probably null
R4665:Fam160a1 UTSW 3 85730681 missense probably damaging 1.00
R4673:Fam160a1 UTSW 3 85730713 missense probably damaging 1.00
R4707:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4783:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4785:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4825:Fam160a1 UTSW 3 85673432 missense possibly damaging 0.93
R4884:Fam160a1 UTSW 3 85683611 missense probably damaging 1.00
R5653:Fam160a1 UTSW 3 85722501 missense probably damaging 1.00
R5663:Fam160a1 UTSW 3 85672433 missense probably benign
R5764:Fam160a1 UTSW 3 85665865 missense probably damaging 1.00
R6134:Fam160a1 UTSW 3 85673344 missense possibly damaging 0.93
R6284:Fam160a1 UTSW 3 85672688 missense probably benign 0.01
R6843:Fam160a1 UTSW 3 85673045 missense probably damaging 0.96
R7305:Fam160a1 UTSW 3 85730524 missense probably damaging 1.00
R7406:Fam160a1 UTSW 3 85730477 missense probably benign 0.13
R7448:Fam160a1 UTSW 3 85672564 missense probably benign 0.00
R7469:Fam160a1 UTSW 3 85672762 missense probably benign 0.00
R7578:Fam160a1 UTSW 3 85665898 missense probably damaging 0.99
R7707:Fam160a1 UTSW 3 85676253 missense probably benign 0.21
R8071:Fam160a1 UTSW 3 85730561 missense probably damaging 1.00
R8093:Fam160a1 UTSW 3 85672804 missense probably benign 0.01
R8151:Fam160a1 UTSW 3 85688540 missense probably damaging 1.00
R8391:Fam160a1 UTSW 3 85688481 missense probably damaging 0.98
R8406:Fam160a1 UTSW 3 85672720 missense probably benign 0.02
Z1176:Fam160a1 UTSW 3 85673201 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGCTGTGTAAGAAGTGAGGGC -3'
(R):5'- TCAGAGCTACAGGAGGACAC -3'

Sequencing Primer
(F):5'- CTCTGAGATAGGGATGCTCTGCTC -3'
(R):5'- CTACAGGAGGACACTGCGG -3'
Posted On2018-08-29