Incidental Mutation 'R6789:BC005561'
ID532929
Institutional Source Beutler Lab
Gene Symbol BC005561
Ensembl Gene ENSMUSG00000079065
Gene NamecDNA sequence BC005561
Synonyms
Accession Numbers

Genbank: NM_001166581; MGI: 3040669

Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R6789 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location104508352-104522611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104517689 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 26 (F26L)
Ref Sequence ENSEMBL: ENSMUSP00000130629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096452]
Predicted Effect probably benign
Transcript: ENSMUST00000096452
AA Change: F26L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065
AA Change: F26L

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox2 T A 1: 58,304,485 D442E probably benign Het
Arl6ip4 G A 5: 124,116,602 G53R probably damaging Het
Asns T C 6: 7,675,344 T553A probably benign Het
Atp1a1 T A 3: 101,586,298 N497Y possibly damaging Het
Birc2 T C 9: 7,836,965 probably benign Het
Catsperd C A 17: 56,654,426 probably null Het
Dchs1 G T 7: 105,757,003 Q2341K possibly damaging Het
Dydc2 C A 14: 41,049,339 V128L probably benign Het
Efna3 C T 3: 89,316,462 probably null Het
Fam160a1 A T 3: 85,672,558 L780* probably null Het
Fbn2 C T 18: 58,010,614 E2790K probably benign Het
Gm11569 C A 11: 99,798,831 probably benign Het
Gprc6a C T 10: 51,631,316 G39D probably damaging Het
Igkv6-17 A G 6: 70,371,708 D21G probably benign Het
Klra4 T C 6: 130,062,219 Q70R probably damaging Het
Krtap31-2 C T 11: 99,936,723 S127F possibly damaging Het
Lingo4 G T 3: 94,399,355 probably benign Het
Lrp2bp A G 8: 46,013,114 K87E possibly damaging Het
Macf1 A T 4: 123,372,438 M5333K probably damaging Het
Mmp13 A T 9: 7,272,781 Y47F probably benign Het
Muc16 G A 9: 18,559,986 P7261S probably benign Het
Nostrin G T 2: 69,175,512 M212I probably benign Het
Nr1h5 G A 3: 102,958,361 T8M possibly damaging Het
Nup153 A T 13: 46,717,316 L41H probably damaging Het
Olfr1358 T C 10: 78,519,968 L120P noncoding transcript Het
Olfr1447 T A 19: 12,901,289 I164L probably benign Het
Pappa A T 4: 65,181,041 D599V probably damaging Het
Pcdh18 G A 3: 49,755,915 T317I probably benign Het
Pcsk5 T A 19: 17,456,786 N1406I possibly damaging Het
Pik3c2a A T 7: 116,362,184 Y1027N probably damaging Het
Prpf6 T A 2: 181,616,051 Y105* probably null Het
Rab5a C T 17: 53,497,622 P87S probably damaging Het
Rnf8 T A 17: 29,635,869 W433R probably damaging Het
Slc18b1 T A 10: 23,816,329 V232D probably benign Het
Taf11 C A 17: 27,907,518 A52S probably benign Het
Trav9-2 T C 14: 53,591,362 L63P possibly damaging Het
Wdr34 A G 2: 30,033,272 probably null Het
Zfat T C 15: 68,084,386 Y1199C probably damaging Het
Other mutations in BC005561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:BC005561 APN 5 104520500 missense probably damaging 1.00
IGL01024:BC005561 APN 5 104521746 missense probably benign 0.02
IGL01133:BC005561 APN 5 104517662 missense probably benign
IGL01564:BC005561 APN 5 104520663 missense probably benign 0.12
IGL01727:BC005561 APN 5 104519513 missense probably benign 0.01
IGL02086:BC005561 APN 5 104519001 missense possibly damaging 0.49
IGL02153:BC005561 APN 5 104521083 missense probably benign 0.02
IGL02256:BC005561 APN 5 104520283 nonsense probably null
IGL02436:BC005561 APN 5 104521155 missense probably benign 0.10
IGL02969:BC005561 APN 5 104519343 missense probably benign 0.01
IGL03275:BC005561 APN 5 104518277 missense probably benign 0.00
IGL03357:BC005561 APN 5 104520468 missense probably damaging 1.00
F2404:BC005561 UTSW 5 104520230 missense possibly damaging 0.83
R0318:BC005561 UTSW 5 104517753 missense probably benign 0.00
R0349:BC005561 UTSW 5 104519976 missense possibly damaging 0.85
R0454:BC005561 UTSW 5 104518211 missense probably benign 0.45
R0742:BC005561 UTSW 5 104522154 missense probably benign 0.00
R0842:BC005561 UTSW 5 104519200 missense possibly damaging 0.81
R0882:BC005561 UTSW 5 104519009 missense probably benign 0.05
R1123:BC005561 UTSW 5 104518470 missense probably damaging 1.00
R1171:BC005561 UTSW 5 104520903 missense possibly damaging 0.49
R1205:BC005561 UTSW 5 104520213 missense probably benign 0.28
R1261:BC005561 UTSW 5 104520635 missense probably damaging 0.98
R1432:BC005561 UTSW 5 104518104 missense probably damaging 1.00
R1447:BC005561 UTSW 5 104522204 missense possibly damaging 0.89
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1584:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1636:BC005561 UTSW 5 104520750 missense probably damaging 0.99
R1686:BC005561 UTSW 5 104519923 nonsense probably null
R1698:BC005561 UTSW 5 104520510 missense probably benign 0.09
R1816:BC005561 UTSW 5 104517834 missense probably benign 0.16
R1903:BC005561 UTSW 5 104518330 missense probably benign 0.00
R2096:BC005561 UTSW 5 104519969 missense possibly damaging 0.95
R2146:BC005561 UTSW 5 104518991 missense probably benign
R2226:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2227:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2383:BC005561 UTSW 5 104518988 missense probably benign 0.23
R2656:BC005561 UTSW 5 104519315 missense probably benign 0.05
R3982:BC005561 UTSW 5 104521023 missense probably benign 0.29
R3983:BC005561 UTSW 5 104521023 missense probably benign 0.29
R4115:BC005561 UTSW 5 104519433 missense probably damaging 1.00
R4345:BC005561 UTSW 5 104521449 missense probably benign 0.21
R4697:BC005561 UTSW 5 104522240 missense probably benign 0.00
R4711:BC005561 UTSW 5 104519661 missense probably damaging 0.98
R4742:BC005561 UTSW 5 104518857 missense probably benign 0.17
R4758:BC005561 UTSW 5 104520399 missense possibly damaging 0.48
R4863:BC005561 UTSW 5 104517750 missense possibly damaging 0.89
R4867:BC005561 UTSW 5 104521002 missense possibly damaging 0.91
R5024:BC005561 UTSW 5 104522258 missense possibly damaging 0.68
R5114:BC005561 UTSW 5 104519876 missense probably damaging 0.99
R5117:BC005561 UTSW 5 104520255 missense probably damaging 1.00
R5289:BC005561 UTSW 5 104519657 missense probably benign 0.03
R5341:BC005561 UTSW 5 104518076 missense probably damaging 1.00
R5420:BC005561 UTSW 5 104518359 missense probably damaging 0.99
R5421:BC005561 UTSW 5 104518395 missense probably benign 0.01
R5422:BC005561 UTSW 5 104519646 missense probably damaging 0.98
R5606:BC005561 UTSW 5 104521878 missense probably benign 0.00
R5939:BC005561 UTSW 5 104519207 missense possibly damaging 0.56
R6104:BC005561 UTSW 5 104518218 missense probably damaging 1.00
R6169:BC005561 UTSW 5 104518396 missense probably benign 0.00
R6316:BC005561 UTSW 5 104519729 missense probably damaging 1.00
R6352:BC005561 UTSW 5 104520198 missense probably benign 0.11
R6408:BC005561 UTSW 5 104518777 missense probably benign 0.19
R6458:BC005561 UTSW 5 104522303 missense probably benign 0.02
R6722:BC005561 UTSW 5 104520279 missense probably damaging 0.99
R7214:BC005561 UTSW 5 104522363 missense probably benign
R7494:BC005561 UTSW 5 104518418 missense possibly damaging 0.90
R7733:BC005561 UTSW 5 104519960 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGAGCTGGTCTTTCCTTGAAC -3'
(R):5'- GCCCAATGACCCCAATGTTTC -3'

Sequencing Primer
(F):5'- TTCCTTGAACCTCCTGGAAGCAAG -3'
(R):5'- CAATGTTTCTGGATCCAAGCG -3'
Posted On2018-08-29