Mutagenetix > Incidental Mutations

Incidental Mutation 'R6789:Muc16'

532939

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.200) question?

Stock #

R6789 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 18559986 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 7261 (P7261S)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

unknown
Transcript: ENSMUST00000207857
AA Change: P1348S

Predicted Effect

probably benign
Transcript: ENSMUST00000208663
AA Change: P7261S

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox2	T	A	1: 58,304,485	D442E	probably benign	Het
Arl6ip4	G	A	5: 124,116,602	G53R	probably damaging	Het
Asns	T	C	6: 7,675,344	T553A	probably benign	Het
Atp1a1	T	A	3: 101,586,298	N497Y	possibly damaging	Het
BC005561	T	C	5: 104,517,689	F26L	probably benign	Het
Birc2	T	C	9: 7,836,965		probably benign	Het
Catsperd	C	A	17: 56,654,426		probably null	Het
Dchs1	G	T	7: 105,757,003	Q2341K	possibly damaging	Het
Dydc2	C	A	14: 41,049,339	V128L	probably benign	Het
Efna3	C	T	3: 89,316,462		probably null	Het
Fam160a1	A	T	3: 85,672,558	L780*	probably null	Het
Fbn2	C	T	18: 58,010,614	E2790K	probably benign	Het
Gm11569	C	A	11: 99,798,831		probably benign	Het
Gprc6a	C	T	10: 51,631,316	G39D	probably damaging	Het
Igkv6-17	A	G	6: 70,371,708	D21G	probably benign	Het
Klra4	T	C	6: 130,062,219	Q70R	probably damaging	Het
Krtap31-2	C	T	11: 99,936,723	S127F	possibly damaging	Het
Lingo4	G	T	3: 94,399,355		probably benign	Het
Lrp2bp	A	G	8: 46,013,114	K87E	possibly damaging	Het
Macf1	A	T	4: 123,372,438	M5333K	probably damaging	Het
Mmp13	A	T	9: 7,272,781	Y47F	probably benign	Het
Nostrin	G	T	2: 69,175,512	M212I	probably benign	Het
Nr1h5	G	A	3: 102,958,361	T8M	possibly damaging	Het
Nup153	A	T	13: 46,717,316	L41H	probably damaging	Het
Olfr1358	T	C	10: 78,519,968	L120P	noncoding transcript	Het
Olfr1447	T	A	19: 12,901,289	I164L	probably benign	Het
Pappa	A	T	4: 65,181,041	D599V	probably damaging	Het
Pcdh18	G	A	3: 49,755,915	T317I	probably benign	Het
Pcsk5	T	A	19: 17,456,786	N1406I	possibly damaging	Het
Pik3c2a	A	T	7: 116,362,184	Y1027N	probably damaging	Het
Prpf6	T	A	2: 181,616,051	Y105*	probably null	Het
Rab5a	C	T	17: 53,497,622	P87S	probably damaging	Het
Rnf8	T	A	17: 29,635,869	W433R	probably damaging	Het
Slc18b1	T	A	10: 23,816,329	V232D	probably benign	Het
Taf11	C	A	17: 27,907,518	A52S	probably benign	Het
Trav9-2	T	C	14: 53,591,362	L63P	possibly damaging	Het
Wdr34	A	G	2: 30,033,272		probably null	Het
Zfat	T	C	15: 68,084,386	Y1199C	probably damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	intron	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	intron	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AATGAACAGAGCAGAGTCTTCC -3'
(R):5'- TCCCAGTTTATTGGCTAAGAACAAG -3'

Sequencing Primer
(F):5'- TGAGGGTTTCCTGAAAGT -3'
(R):5'- TGGCCAGCTCTACCCAC -3'

Posted On

2018-08-29