Incidental Mutation 'R6795:Gm8298'
ID532960
Institutional Source Beutler Lab
Gene Symbol Gm8298
Ensembl Gene ENSMUSG00000095522
Gene Namepredicted gene 8298
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6795 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location59861051-59877313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59868936 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 176 (Y176F)
Ref Sequence ENSEMBL: ENSMUSP00000137307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179799]
Predicted Effect probably damaging
Transcript: ENSMUST00000179799
AA Change: Y176F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137307
Gene: ENSMUSG00000095522
AA Change: Y176F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:COesterase 91 217 9.6e-7 PFAM
Pfam:Abhydrolase_3 107 279 1.1e-36 PFAM
Pfam:Abhydrolase_3 284 375 1.2e-11 PFAM
Meta Mutation Damage Score 0.2604 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C A 4: 73,950,828 probably benign Het
A2m T A 6: 121,648,322 probably null Het
Agps A G 2: 75,894,058 D472G probably damaging Het
Amfr A G 8: 94,000,333 V158A probably benign Het
Birc2 A G 9: 7,833,872 Y203H possibly damaging Het
Calr4 A G 4: 109,244,788 N147D probably damaging Het
Cd8b1 T A 6: 71,326,340 L133Q probably damaging Het
Cenpn T A 8: 116,926,148 S19R probably benign Het
Ces2g A G 8: 104,967,817 N494S probably damaging Het
Ces3a G A 8: 105,050,596 G184R possibly damaging Het
Dlgap1 C A 17: 70,818,074 A614E possibly damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
Ephb2 A C 4: 136,673,335 L544R possibly damaging Het
Fanca T A 8: 123,318,493 T21S probably benign Het
Fsip2 A T 2: 82,980,959 M2541L probably benign Het
Galnt2 T C 8: 124,343,436 F530S probably damaging Het
Gm19410 G A 8: 35,795,522 C871Y probably damaging Het
Gmds C T 13: 32,234,352 probably null Het
Hectd1 A G 12: 51,794,487 V620A possibly damaging Het
Myo18b T C 5: 112,846,364 T908A probably damaging Het
Olfr73 C T 2: 88,034,324 V272I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcf11 A C 7: 92,657,578 N1127K probably benign Het
Plec T C 15: 76,180,138 K1979E probably damaging Het
Prpf38b T C 3: 108,904,664 probably benign Het
Sema5b T A 16: 35,658,571 C588* probably null Het
Skint5 C T 4: 113,667,223 E854K unknown Het
Slc25a42 A G 8: 70,188,390 Y187H probably damaging Het
Slc30a5 A T 13: 100,817,069 D182E probably damaging Het
Synrg A G 11: 84,019,914 I1047V probably damaging Het
Tbc1d31 A G 15: 57,951,706 D593G probably damaging Het
Thnsl1 C T 2: 21,213,492 Q165* probably null Het
Ttc6 T C 12: 57,704,413 F1364L probably damaging Het
Ttf2 G A 3: 100,959,262 A518V probably damaging Het
Vmn1r6 A G 6: 57,002,437 Y28C possibly damaging Het
Zzef1 A G 11: 72,850,659 E709G probably benign Het
Other mutations in Gm8298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Gm8298 APN 3 59868900 missense possibly damaging 0.80
IGL02064:Gm8298 APN 3 59877042 missense probably damaging 1.00
IGL02317:Gm8298 APN 3 59876987 missense probably benign 0.00
R0270:Gm8298 UTSW 3 59877019 missense probably benign
R0580:Gm8298 UTSW 3 59877049 missense probably damaging 1.00
R1124:Gm8298 UTSW 3 59865218 missense probably benign 0.39
R1208:Gm8298 UTSW 3 59865294 missense probably benign 0.27
R1222:Gm8298 UTSW 3 59877261 nonsense probably null
R1436:Gm8298 UTSW 3 59865339 missense probably damaging 0.98
R1529:Gm8298 UTSW 3 59861112 missense probably benign
R1806:Gm8298 UTSW 3 59877150 missense probably damaging 1.00
R2130:Gm8298 UTSW 3 59865348 missense probably damaging 1.00
R4209:Gm8298 UTSW 3 59877156 missense probably damaging 1.00
R4597:Gm8298 UTSW 3 59876793 missense possibly damaging 0.47
R4910:Gm8298 UTSW 3 59869014 critical splice donor site probably null
R5571:Gm8298 UTSW 3 59877219 missense probably damaging 1.00
R6131:Gm8298 UTSW 3 59868903 missense possibly damaging 0.76
R6447:Gm8298 UTSW 3 59865398 missense probably damaging 0.99
R6481:Gm8298 UTSW 3 59861057 missense probably benign 0.00
R7092:Gm8298 UTSW 3 59861079 missense probably benign 0.41
R7334:Gm8298 UTSW 3 59868959 missense probably damaging 1.00
R7602:Gm8298 UTSW 3 59877276 missense probably benign 0.17
R7660:Gm8298 UTSW 3 59865268 missense probably benign 0.05
R7705:Gm8298 UTSW 3 59876747 missense probably benign 0.25
R7708:Gm8298 UTSW 3 59865335 missense probably benign 0.00
X0011:Gm8298 UTSW 3 59861177 missense probably benign
X0022:Gm8298 UTSW 3 59877024 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAATTAAACGTTCAAAGTGGGC -3'
(R):5'- CACACAACATTGGACATTGGATTC -3'

Sequencing Primer
(F):5'- CCATAATTTCTCCACTGGC -3'
(R):5'- GGATTCAATGCTCAGTAAACATGCAC -3'
Posted On2018-08-29