Incidental Mutation 'R6795:Prpf38b'
ID532962
Institutional Source Beutler Lab
Gene Symbol Prpf38b
Ensembl Gene ENSMUSG00000027881
Gene NamePRP38 pre-mRNA processing factor 38 (yeast) domain containing B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6795 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108902805-108911727 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 108904664 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029480] [ENSMUST00000129273] [ENSMUST00000199735]
Predicted Effect unknown
Transcript: ENSMUST00000029480
AA Change: E295G
SMART Domains Protein: ENSMUSP00000029480
Gene: ENSMUSG00000027881
AA Change: E295G

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Pfam:PRP38 48 232 5.4e-59 PFAM
low complexity region 240 253 N/A INTRINSIC
low complexity region 257 291 N/A INTRINSIC
coiled coil region 293 322 N/A INTRINSIC
low complexity region 400 439 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
low complexity region 480 506 N/A INTRINSIC
low complexity region 510 534 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129273
SMART Domains Protein: ENSMUSP00000143724
Gene: ENSMUSG00000027881

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Pfam:PRP38 48 93 2.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199735
SMART Domains Protein: ENSMUSP00000142929
Gene: ENSMUSG00000027881

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Pfam:PRP38 43 150 2e-16 PFAM
Meta Mutation Damage Score 0.1046 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C A 4: 73,950,828 probably benign Het
A2m T A 6: 121,648,322 probably null Het
Agps A G 2: 75,894,058 D472G probably damaging Het
Amfr A G 8: 94,000,333 V158A probably benign Het
Birc2 A G 9: 7,833,872 Y203H possibly damaging Het
Calr4 A G 4: 109,244,788 N147D probably damaging Het
Cd8b1 T A 6: 71,326,340 L133Q probably damaging Het
Cenpn T A 8: 116,926,148 S19R probably benign Het
Ces2g A G 8: 104,967,817 N494S probably damaging Het
Ces3a G A 8: 105,050,596 G184R possibly damaging Het
Dlgap1 C A 17: 70,818,074 A614E possibly damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
Ephb2 A C 4: 136,673,335 L544R possibly damaging Het
Fanca T A 8: 123,318,493 T21S probably benign Het
Fsip2 A T 2: 82,980,959 M2541L probably benign Het
Galnt2 T C 8: 124,343,436 F530S probably damaging Het
Gm19410 G A 8: 35,795,522 C871Y probably damaging Het
Gm8298 A T 3: 59,868,936 Y176F probably damaging Het
Gmds C T 13: 32,234,352 probably null Het
Hectd1 A G 12: 51,794,487 V620A possibly damaging Het
Myo18b T C 5: 112,846,364 T908A probably damaging Het
Olfr73 C T 2: 88,034,324 V272I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcf11 A C 7: 92,657,578 N1127K probably benign Het
Plec T C 15: 76,180,138 K1979E probably damaging Het
Sema5b T A 16: 35,658,571 C588* probably null Het
Skint5 C T 4: 113,667,223 E854K unknown Het
Slc25a42 A G 8: 70,188,390 Y187H probably damaging Het
Slc30a5 A T 13: 100,817,069 D182E probably damaging Het
Synrg A G 11: 84,019,914 I1047V probably damaging Het
Tbc1d31 A G 15: 57,951,706 D593G probably damaging Het
Thnsl1 C T 2: 21,213,492 Q165* probably null Het
Ttc6 T C 12: 57,704,413 F1364L probably damaging Het
Ttf2 G A 3: 100,959,262 A518V probably damaging Het
Vmn1r6 A G 6: 57,002,437 Y28C possibly damaging Het
Zzef1 A G 11: 72,850,659 E709G probably benign Het
Other mutations in Prpf38b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Prpf38b APN 3 108904675 missense probably benign 0.23
IGL03145:Prpf38b APN 3 108903945 utr 3 prime probably benign
IGL03269:Prpf38b APN 3 108905241 missense probably benign 0.23
R0482:Prpf38b UTSW 3 108905270 missense probably damaging 1.00
R0765:Prpf38b UTSW 3 108911418 missense possibly damaging 0.53
R3724:Prpf38b UTSW 3 108904340 utr 3 prime probably benign
R3934:Prpf38b UTSW 3 108904425 utr 3 prime probably benign
R4367:Prpf38b UTSW 3 108911171 missense probably damaging 1.00
R4649:Prpf38b UTSW 3 108904092 utr 3 prime probably benign
R4651:Prpf38b UTSW 3 108904092 utr 3 prime probably benign
R4653:Prpf38b UTSW 3 108904092 utr 3 prime probably benign
R5073:Prpf38b UTSW 3 108911168 missense probably damaging 1.00
R6979:Prpf38b UTSW 3 108911324 missense probably benign 0.01
R7500:Prpf38b UTSW 3 108905130 missense probably benign 0.33
R8045:Prpf38b UTSW 3 108904034 missense unknown
R8210:Prpf38b UTSW 3 108907832 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- TGGAGCGCTCTCTTGATCTC -3'
(R):5'- GTAAGTGTTCCACTGAGCTGC -3'

Sequencing Primer
(F):5'- ATAATCTCGGTCTCGTCTTCGAC -3'
(R):5'- TGAGCTGCAGGTATCCCG -3'
Posted On2018-08-29