Incidental Mutation 'R6795:Vmn1r6'
ID532968
Institutional Source Beutler Lab
Gene Symbol Vmn1r6
Ensembl Gene ENSMUSG00000115701
Gene Namevomeronasal 1 receptor 6
SynonymsV1rc20
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6795 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location56997243-57009825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57002437 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 28 (Y28C)
Ref Sequence ENSEMBL: ENSMUSP00000078611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079669] [ENSMUST00000226689] [ENSMUST00000227131] [ENSMUST00000227188] [ENSMUST00000227631] [ENSMUST00000227847] [ENSMUST00000228285]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079669
AA Change: Y28C

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078611
Gene: ENSMUSG00000115701
AA Change: Y28C

DomainStartEndE-ValueType
Pfam:V1R 28 293 4.9e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226689
AA Change: Y28C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227131
AA Change: Y28C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227847
AA Change: Y28C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228285
AA Change: Y28C
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C A 4: 73,950,828 probably benign Het
A2m T A 6: 121,648,322 probably null Het
Agps A G 2: 75,894,058 D472G probably damaging Het
Amfr A G 8: 94,000,333 V158A probably benign Het
Birc2 A G 9: 7,833,872 Y203H possibly damaging Het
Calr4 A G 4: 109,244,788 N147D probably damaging Het
Cd8b1 T A 6: 71,326,340 L133Q probably damaging Het
Cenpn T A 8: 116,926,148 S19R probably benign Het
Ces2g A G 8: 104,967,817 N494S probably damaging Het
Ces3a G A 8: 105,050,596 G184R possibly damaging Het
Dlgap1 C A 17: 70,818,074 A614E possibly damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
Ephb2 A C 4: 136,673,335 L544R possibly damaging Het
Fanca T A 8: 123,318,493 T21S probably benign Het
Fsip2 A T 2: 82,980,959 M2541L probably benign Het
Galnt2 T C 8: 124,343,436 F530S probably damaging Het
Gm19410 G A 8: 35,795,522 C871Y probably damaging Het
Gm8298 A T 3: 59,868,936 Y176F probably damaging Het
Gmds C T 13: 32,234,352 probably null Het
Hectd1 A G 12: 51,794,487 V620A possibly damaging Het
Myo18b T C 5: 112,846,364 T908A probably damaging Het
Olfr73 C T 2: 88,034,324 V272I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcf11 A C 7: 92,657,578 N1127K probably benign Het
Plec T C 15: 76,180,138 K1979E probably damaging Het
Prpf38b T C 3: 108,904,664 probably benign Het
Sema5b T A 16: 35,658,571 C588* probably null Het
Skint5 C T 4: 113,667,223 E854K unknown Het
Slc25a42 A G 8: 70,188,390 Y187H probably damaging Het
Slc30a5 A T 13: 100,817,069 D182E probably damaging Het
Synrg A G 11: 84,019,914 I1047V probably damaging Het
Tbc1d31 A G 15: 57,951,706 D593G probably damaging Het
Thnsl1 C T 2: 21,213,492 Q165* probably null Het
Ttc6 T C 12: 57,704,413 F1364L probably damaging Het
Ttf2 G A 3: 100,959,262 A518V probably damaging Het
Zzef1 A G 11: 72,850,659 E709G probably benign Het
Other mutations in Vmn1r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Vmn1r6 APN 6 57002804 missense probably damaging 1.00
IGL01011:Vmn1r6 APN 6 57002544 missense probably benign 0.00
IGL01147:Vmn1r6 APN 6 57002641 missense probably damaging 1.00
IGL01475:Vmn1r6 APN 6 57002911 missense probably damaging 1.00
IGL01638:Vmn1r6 APN 6 57003192 nonsense probably null
IGL01860:Vmn1r6 APN 6 57002689 nonsense probably null
IGL01876:Vmn1r6 APN 6 57002461 missense probably benign 0.12
IGL01988:Vmn1r6 APN 6 57002665 missense probably damaging 0.99
R0531:Vmn1r6 UTSW 6 57002598 missense probably benign 0.00
R1495:Vmn1r6 UTSW 6 57003073 missense possibly damaging 0.58
R1733:Vmn1r6 UTSW 6 57002622 missense probably damaging 1.00
R2037:Vmn1r6 UTSW 6 57003124 missense probably damaging 1.00
R3625:Vmn1r6 UTSW 6 57002935 missense probably damaging 0.96
R4353:Vmn1r6 UTSW 6 57002692 missense possibly damaging 0.63
R4484:Vmn1r6 UTSW 6 57003189 missense probably benign
R4854:Vmn1r6 UTSW 6 57002698 missense probably benign 0.00
R5237:Vmn1r6 UTSW 6 57003194 missense probably damaging 1.00
R5341:Vmn1r6 UTSW 6 57002804 missense probably damaging 1.00
R5611:Vmn1r6 UTSW 6 57002377 missense probably damaging 1.00
R8423:Vmn1r6 UTSW 6 57002510 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CCGAGCCACTAAGTGAGTATTC -3'
(R):5'- GTGGTACAGATAGAGAGGCCTC -3'

Sequencing Primer
(F):5'- CGAGCCACTAAGTGAGTATTCTGTAC -3'
(R):5'- AGAGGCCTCTCATCACCCTG -3'
Posted On2018-08-29