Incidental Mutation 'R6795:Slc25a42'
ID532973
Institutional Source Beutler Lab
Gene Symbol Slc25a42
Ensembl Gene ENSMUSG00000002346
Gene Namesolute carrier family 25, member 42
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6795 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70184340-70212305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70188390 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 187 (Y187H)
Ref Sequence ENSEMBL: ENSMUSP00000105754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002413] [ENSMUST00000063788] [ENSMUST00000110127] [ENSMUST00000182715]
Predicted Effect probably benign
Transcript: ENSMUST00000002413
SMART Domains Protein: ENSMUSP00000002413
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 478 6.8e-182 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063788
AA Change: Y187H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065903
Gene: ENSMUSG00000002346
AA Change: Y187H

DomainStartEndE-ValueType
Pfam:Mito_carr 29 122 3.4e-23 PFAM
Pfam:Mito_carr 127 219 1.4e-26 PFAM
Pfam:Mito_carr 222 316 3.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110127
AA Change: Y187H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105754
Gene: ENSMUSG00000002346
AA Change: Y187H

DomainStartEndE-ValueType
Pfam:Mito_carr 29 122 1.6e-23 PFAM
Pfam:Mito_carr 127 219 7.2e-27 PFAM
Pfam:Mito_carr 222 317 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182715
SMART Domains Protein: ENSMUSP00000138432
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 45 3.3e-15 PFAM
low complexity region 152 165 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
Meta Mutation Damage Score 0.9719 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a solute carrier family 25 protein. Solute carrier family 25 proteins are localized to mitochondria and play critical roles in the transport of molecules across the inner mitochondrial membrane. The encoded protein is a mitochondrial transporter for coenzyme A (CoA) and adenosine 3',5'-diphosphate. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C A 4: 73,950,828 probably benign Het
A2m T A 6: 121,648,322 probably null Het
Agps A G 2: 75,894,058 D472G probably damaging Het
Amfr A G 8: 94,000,333 V158A probably benign Het
Birc2 A G 9: 7,833,872 Y203H possibly damaging Het
Calr4 A G 4: 109,244,788 N147D probably damaging Het
Cd8b1 T A 6: 71,326,340 L133Q probably damaging Het
Cenpn T A 8: 116,926,148 S19R probably benign Het
Ces2g A G 8: 104,967,817 N494S probably damaging Het
Ces3a G A 8: 105,050,596 G184R possibly damaging Het
Dlgap1 C A 17: 70,818,074 A614E possibly damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
Ephb2 A C 4: 136,673,335 L544R possibly damaging Het
Fanca T A 8: 123,318,493 T21S probably benign Het
Fsip2 A T 2: 82,980,959 M2541L probably benign Het
Galnt2 T C 8: 124,343,436 F530S probably damaging Het
Gm19410 G A 8: 35,795,522 C871Y probably damaging Het
Gm8298 A T 3: 59,868,936 Y176F probably damaging Het
Gmds C T 13: 32,234,352 probably null Het
Hectd1 A G 12: 51,794,487 V620A possibly damaging Het
Myo18b T C 5: 112,846,364 T908A probably damaging Het
Olfr73 C T 2: 88,034,324 V272I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcf11 A C 7: 92,657,578 N1127K probably benign Het
Plec T C 15: 76,180,138 K1979E probably damaging Het
Prpf38b T C 3: 108,904,664 probably benign Het
Sema5b T A 16: 35,658,571 C588* probably null Het
Skint5 C T 4: 113,667,223 E854K unknown Het
Slc30a5 A T 13: 100,817,069 D182E probably damaging Het
Synrg A G 11: 84,019,914 I1047V probably damaging Het
Tbc1d31 A G 15: 57,951,706 D593G probably damaging Het
Thnsl1 C T 2: 21,213,492 Q165* probably null Het
Ttc6 T C 12: 57,704,413 F1364L probably damaging Het
Ttf2 G A 3: 100,959,262 A518V probably damaging Het
Vmn1r6 A G 6: 57,002,437 Y28C possibly damaging Het
Zzef1 A G 11: 72,850,659 E709G probably benign Het
Other mutations in Slc25a42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Slc25a42 APN 8 70189442 missense probably benign
IGL01651:Slc25a42 APN 8 70186600 missense possibly damaging 0.92
R0892:Slc25a42 UTSW 8 70191947 missense probably damaging 0.97
R1990:Slc25a42 UTSW 8 70191869 missense probably benign 0.41
R4567:Slc25a42 UTSW 8 70188854 missense probably damaging 0.99
R4717:Slc25a42 UTSW 8 70189457 missense probably damaging 1.00
R6927:Slc25a42 UTSW 8 70188923 missense probably damaging 0.96
R7011:Slc25a42 UTSW 8 70186702 missense probably damaging 1.00
R7220:Slc25a42 UTSW 8 70189498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAGGTTGCAGCCCAAG -3'
(R):5'- AGCCAAGTGACTGCAGTGTG -3'

Sequencing Primer
(F):5'- AATTGGGCTCTGGATCCCTGC -3'
(R):5'- ACTGCAGTGTGGGAGGC -3'
Posted On2018-08-29