Incidental Mutation 'R6795:Galnt2'
ID532979
Institutional Source Beutler Lab
Gene Symbol Galnt2
Ensembl Gene ENSMUSG00000089704
Gene Namepolypeptide N-acetylgalactosaminyltransferase 2
SynonymsppGaNTase-T2
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_139272.2; MGI:894694

Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R6795 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124231391-124345724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124343436 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 530 (F530S)
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034458] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000034458
AA Change: F564S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034458
Gene: ENSMUSG00000089704
AA Change: F564S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 25 39 N/A INTRINSIC
Pfam:Glycos_transf_2 138 321 8.3e-31 PFAM
Pfam:Glyco_transf_7C 295 365 5.4e-8 PFAM
RICIN 440 565 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127664
AA Change: F530S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329
AA Change: F530S

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.9132 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI

None

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C A 4: 73,950,828 probably benign Het
A2m T A 6: 121,648,322 probably null Het
Agps A G 2: 75,894,058 D472G probably damaging Het
Amfr A G 8: 94,000,333 V158A probably benign Het
Birc2 A G 9: 7,833,872 Y203H possibly damaging Het
Calr4 A G 4: 109,244,788 N147D probably damaging Het
Cd8b1 T A 6: 71,326,340 L133Q probably damaging Het
Cenpn T A 8: 116,926,148 S19R probably benign Het
Ces2g A G 8: 104,967,817 N494S probably damaging Het
Ces3a G A 8: 105,050,596 G184R possibly damaging Het
Dlgap1 C A 17: 70,818,074 A614E possibly damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
Ephb2 A C 4: 136,673,335 L544R possibly damaging Het
Fanca T A 8: 123,318,493 T21S probably benign Het
Fsip2 A T 2: 82,980,959 M2541L probably benign Het
Gm19410 G A 8: 35,795,522 C871Y probably damaging Het
Gm8298 A T 3: 59,868,936 Y176F probably damaging Het
Gmds C T 13: 32,234,352 probably null Het
Hectd1 A G 12: 51,794,487 V620A possibly damaging Het
Myo18b T C 5: 112,846,364 T908A probably damaging Het
Olfr73 C T 2: 88,034,324 V272I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcf11 A C 7: 92,657,578 N1127K probably benign Het
Plec T C 15: 76,180,138 K1979E probably damaging Het
Prpf38b T C 3: 108,904,664 probably benign Het
Sema5b T A 16: 35,658,571 C588* probably null Het
Skint5 C T 4: 113,667,223 E854K unknown Het
Slc25a42 A G 8: 70,188,390 Y187H probably damaging Het
Slc30a5 A T 13: 100,817,069 D182E probably damaging Het
Synrg A G 11: 84,019,914 I1047V probably damaging Het
Tbc1d31 A G 15: 57,951,706 D593G probably damaging Het
Thnsl1 C T 2: 21,213,492 Q165* probably null Het
Ttc6 T C 12: 57,704,413 F1364L probably damaging Het
Ttf2 G A 3: 100,959,262 A518V probably damaging Het
Vmn1r6 A G 6: 57,002,437 Y28C possibly damaging Het
Zzef1 A G 11: 72,850,659 E709G probably benign Het
Other mutations in Galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Galnt2 APN 8 124305506 splice site probably benign
IGL02638:Galnt2 APN 8 124231579 missense probably damaging 0.98
gallantry UTSW 8 124340822 missense probably damaging 1.00
P0018:Galnt2 UTSW 8 124336611 missense probably damaging 1.00
R0133:Galnt2 UTSW 8 124338538 missense probably benign 0.19
R0453:Galnt2 UTSW 8 124338584 splice site probably benign
R0709:Galnt2 UTSW 8 124343346 missense probably benign 0.01
R1015:Galnt2 UTSW 8 124336617 missense probably benign
R4388:Galnt2 UTSW 8 124295453 critical splice donor site probably null
R4400:Galnt2 UTSW 8 124324303 missense probably damaging 1.00
R4447:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4448:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4449:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4450:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4927:Galnt2 UTSW 8 124305623 missense probably damaging 1.00
R5536:Galnt2 UTSW 8 124323673 missense probably damaging 1.00
R6218:Galnt2 UTSW 8 124343315 missense probably benign 0.01
R6732:Galnt2 UTSW 8 124340822 missense probably damaging 1.00
R6823:Galnt2 UTSW 8 124324011 missense probably benign
R7173:Galnt2 UTSW 8 124305553 missense probably benign 0.00
R7479:Galnt2 UTSW 8 124334338 missense probably damaging 1.00
R7818:Galnt2 UTSW 8 124329788 missense probably damaging 1.00
R7821:Galnt2 UTSW 8 124343395 missense possibly damaging 0.51
R7831:Galnt2 UTSW 8 124332078 missense probably benign 0.04
R7914:Galnt2 UTSW 8 124332078 missense probably benign 0.04
X0024:Galnt2 UTSW 8 124343345 missense probably benign 0.28
Z1177:Galnt2 UTSW 8 124343318 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GCCGTTAAAGACTAGGCTCAC -3'
(R):5'- ATGCCTCGATGAAGACTTGAG -3'

Sequencing Primer
(F):5'- GTGTATGCCTGCAGACCCTATG -3'
(R):5'- CTTGAGACTTAAGACTGTCAGACCG -3'
Posted On2018-08-29