Incidental Mutation 'R6795:Synrg'
ID532984
Institutional Source Beutler Lab
Gene Symbol Synrg
Ensembl Gene ENSMUSG00000034940
Gene Namesynergin, gamma
SynonymsAp1gbp1, L71-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6795 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location83964428-84044578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84019914 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1047 (I1047V)
Ref Sequence ENSEMBL: ENSMUSP00000059000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049714] [ENSMUST00000092834] [ENSMUST00000183456] [ENSMUST00000183714]
Predicted Effect probably damaging
Transcript: ENSMUST00000049714
AA Change: I1047V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059000
Gene: ENSMUSG00000034940
AA Change: I1047V

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
coiled coil region 113 153 N/A INTRINSIC
Blast:EH 301 368 8e-6 BLAST
low complexity region 560 569 N/A INTRINSIC
low complexity region 644 662 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1295 1306 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092834
AA Change: I891V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090510
Gene: ENSMUSG00000034940
AA Change: I891V

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 222 289 5e-6 BLAST
low complexity region 481 490 N/A INTRINSIC
low complexity region 565 583 N/A INTRINSIC
internal_repeat_1 617 755 7.57e-6 PROSPERO
internal_repeat_1 746 879 7.57e-6 PROSPERO
low complexity region 880 894 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183456
AA Change: I1070V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138969
Gene: ENSMUSG00000034940
AA Change: I1070V

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
low complexity region 197 209 N/A INTRINSIC
Blast:EH 401 468 7e-6 BLAST
low complexity region 660 669 N/A INTRINSIC
low complexity region 744 762 N/A INTRINSIC
internal_repeat_1 796 934 2.26e-5 PROSPERO
internal_repeat_1 925 1058 2.26e-5 PROSPERO
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183714
AA Change: I969V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139103
Gene: ENSMUSG00000034940
AA Change: I969V

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 300 367 6e-6 BLAST
low complexity region 559 568 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
internal_repeat_1 695 833 1.34e-5 PROSPERO
internal_repeat_1 824 957 1.34e-5 PROSPERO
low complexity region 958 972 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Meta Mutation Damage Score 0.582 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the gamma subunit of AP1 clathrin-adaptor complex. The AP1 complex is located at the trans-Golgi network and associates specific proteins with clathrin-coated vesicles. This encoded protein may act to connect the AP1 complex to other proteins. Alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C A 4: 73,950,828 probably benign Het
A2m T A 6: 121,648,322 probably null Het
Agps A G 2: 75,894,058 D472G probably damaging Het
Amfr A G 8: 94,000,333 V158A probably benign Het
Birc2 A G 9: 7,833,872 Y203H possibly damaging Het
Calr4 A G 4: 109,244,788 N147D probably damaging Het
Cd8b1 T A 6: 71,326,340 L133Q probably damaging Het
Cenpn T A 8: 116,926,148 S19R probably benign Het
Ces2g A G 8: 104,967,817 N494S probably damaging Het
Ces3a G A 8: 105,050,596 G184R possibly damaging Het
Dlgap1 C A 17: 70,818,074 A614E possibly damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
Ephb2 A C 4: 136,673,335 L544R possibly damaging Het
Fanca T A 8: 123,318,493 T21S probably benign Het
Fsip2 A T 2: 82,980,959 M2541L probably benign Het
Galnt2 T C 8: 124,343,436 F530S probably damaging Het
Gm19410 G A 8: 35,795,522 C871Y probably damaging Het
Gm8298 A T 3: 59,868,936 Y176F probably damaging Het
Gmds C T 13: 32,234,352 probably null Het
Hectd1 A G 12: 51,794,487 V620A possibly damaging Het
Myo18b T C 5: 112,846,364 T908A probably damaging Het
Olfr73 C T 2: 88,034,324 V272I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcf11 A C 7: 92,657,578 N1127K probably benign Het
Plec T C 15: 76,180,138 K1979E probably damaging Het
Prpf38b T C 3: 108,904,664 probably benign Het
Sema5b T A 16: 35,658,571 C588* probably null Het
Skint5 C T 4: 113,667,223 E854K unknown Het
Slc25a42 A G 8: 70,188,390 Y187H probably damaging Het
Slc30a5 A T 13: 100,817,069 D182E probably damaging Het
Tbc1d31 A G 15: 57,951,706 D593G probably damaging Het
Thnsl1 C T 2: 21,213,492 Q165* probably null Het
Ttc6 T C 12: 57,704,413 F1364L probably damaging Het
Ttf2 G A 3: 100,959,262 A518V probably damaging Het
Vmn1r6 A G 6: 57,002,437 Y28C possibly damaging Het
Zzef1 A G 11: 72,850,659 E709G probably benign Het
Other mutations in Synrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Synrg APN 11 84039246 missense probably damaging 0.98
IGL01640:Synrg APN 11 83981508 missense probably damaging 1.00
IGL01936:Synrg APN 11 84019705 missense probably benign 0.00
IGL02311:Synrg APN 11 84019804 missense probably benign 0.01
IGL02836:Synrg APN 11 84001978 splice site probably benign
IGL02868:Synrg APN 11 83987050 splice site probably benign
IGL03185:Synrg APN 11 83981479 missense probably damaging 1.00
IGL03224:Synrg APN 11 84039666 missense possibly damaging 0.86
polaris UTSW 11 84019914 missense probably damaging 1.00
P0041:Synrg UTSW 11 83982311 splice site probably benign
R0023:Synrg UTSW 11 84008653 missense probably damaging 1.00
R0044:Synrg UTSW 11 84009181 missense probably damaging 1.00
R0082:Synrg UTSW 11 83987910 splice site probably benign
R0227:Synrg UTSW 11 84009432 missense probably damaging 1.00
R0361:Synrg UTSW 11 84024337 splice site probably null
R0494:Synrg UTSW 11 84019543 missense probably benign
R0548:Synrg UTSW 11 83982188 splice site probably benign
R0744:Synrg UTSW 11 84024305 nonsense probably null
R1114:Synrg UTSW 11 84023436 splice site probably benign
R1240:Synrg UTSW 11 84023356 missense probably damaging 1.00
R1989:Synrg UTSW 11 84019955 critical splice donor site probably null
R2247:Synrg UTSW 11 84009376 missense probably damaging 1.00
R2263:Synrg UTSW 11 83977152 missense possibly damaging 0.79
R2420:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2421:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2937:Synrg UTSW 11 83994354 missense probably damaging 1.00
R3783:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3784:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3785:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3787:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3925:Synrg UTSW 11 84040899 missense probably benign 0.03
R3945:Synrg UTSW 11 84023406 missense probably damaging 1.00
R3950:Synrg UTSW 11 83989815 missense probably damaging 1.00
R5165:Synrg UTSW 11 83990935 missense probably benign 0.02
R5216:Synrg UTSW 11 83982196 missense probably damaging 0.99
R5293:Synrg UTSW 11 83981499 missense probably damaging 1.00
R5561:Synrg UTSW 11 84002240 splice site probably null
R5575:Synrg UTSW 11 84009552 critical splice donor site probably null
R6079:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6085:Synrg UTSW 11 84039661 missense possibly damaging 0.80
R6138:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6259:Synrg UTSW 11 84008658 missense probably damaging 1.00
R6751:Synrg UTSW 11 83981425 missense probably damaging 1.00
R6944:Synrg UTSW 11 84025086 missense probably damaging 1.00
R7092:Synrg UTSW 11 84008857 missense possibly damaging 0.95
R7109:Synrg UTSW 11 84039672 missense possibly damaging 0.82
R7291:Synrg UTSW 11 84009381 missense probably damaging 1.00
R7489:Synrg UTSW 11 83990825 missense probably benign 0.33
U15987:Synrg UTSW 11 84024300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATTTCACCAGGCAGGAC -3'
(R):5'- CCTGCTAAGCAAAGAATCATTACTG -3'

Sequencing Primer
(F):5'- ACATGCCCACGGTGGAC -3'
(R):5'- TTTTTGAATAATGCCTCATTATGTGG -3'
Posted On2018-08-29