Incidental Mutation 'R6795:Tbc1d31'
ID532989
Institutional Source Beutler Lab
Gene Symbol Tbc1d31
Ensembl Gene ENSMUSG00000022364
Gene NameTBC1 domain family, member 31
SynonymsLOC210544, Wdr67, D330013L20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6795 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location57912199-57970067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57951706 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 593 (D593G)
Ref Sequence ENSEMBL: ENSMUSP00000022992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022992]
Predicted Effect probably damaging
Transcript: ENSMUST00000022992
AA Change: D593G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022992
Gene: ENSMUSG00000022364
AA Change: D593G

DomainStartEndE-ValueType
WD40 39 70 3.3e1 SMART
WD40 72 112 7.64e1 SMART
WD40 115 153 1.42e-4 SMART
WD40 156 196 1.03e1 SMART
WD40 199 242 6.6e1 SMART
Blast:WD40 245 292 8e-23 BLAST
WD40 295 334 2.48e0 SMART
Pfam:RabGAP-TBC 427 619 9.5e-11 PFAM
coiled coil region 699 844 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
Meta Mutation Damage Score 0.8763 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C A 4: 73,950,828 probably benign Het
A2m T A 6: 121,648,322 probably null Het
Agps A G 2: 75,894,058 D472G probably damaging Het
Amfr A G 8: 94,000,333 V158A probably benign Het
Birc2 A G 9: 7,833,872 Y203H possibly damaging Het
Calr4 A G 4: 109,244,788 N147D probably damaging Het
Cd8b1 T A 6: 71,326,340 L133Q probably damaging Het
Cenpn T A 8: 116,926,148 S19R probably benign Het
Ces2g A G 8: 104,967,817 N494S probably damaging Het
Ces3a G A 8: 105,050,596 G184R possibly damaging Het
Dlgap1 C A 17: 70,818,074 A614E possibly damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
Ephb2 A C 4: 136,673,335 L544R possibly damaging Het
Fanca T A 8: 123,318,493 T21S probably benign Het
Fsip2 A T 2: 82,980,959 M2541L probably benign Het
Galnt2 T C 8: 124,343,436 F530S probably damaging Het
Gm19410 G A 8: 35,795,522 C871Y probably damaging Het
Gm8298 A T 3: 59,868,936 Y176F probably damaging Het
Gmds C T 13: 32,234,352 probably null Het
Hectd1 A G 12: 51,794,487 V620A possibly damaging Het
Myo18b T C 5: 112,846,364 T908A probably damaging Het
Olfr73 C T 2: 88,034,324 V272I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcf11 A C 7: 92,657,578 N1127K probably benign Het
Plec T C 15: 76,180,138 K1979E probably damaging Het
Prpf38b T C 3: 108,904,664 probably benign Het
Sema5b T A 16: 35,658,571 C588* probably null Het
Skint5 C T 4: 113,667,223 E854K unknown Het
Slc25a42 A G 8: 70,188,390 Y187H probably damaging Het
Slc30a5 A T 13: 100,817,069 D182E probably damaging Het
Synrg A G 11: 84,019,914 I1047V probably damaging Het
Thnsl1 C T 2: 21,213,492 Q165* probably null Het
Ttc6 T C 12: 57,704,413 F1364L probably damaging Het
Ttf2 G A 3: 100,959,262 A518V probably damaging Het
Vmn1r6 A G 6: 57,002,437 Y28C possibly damaging Het
Zzef1 A G 11: 72,850,659 E709G probably benign Het
Other mutations in Tbc1d31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Tbc1d31 APN 15 57940768 missense probably benign 0.03
IGL01955:Tbc1d31 APN 15 57942370 missense probably benign 0.24
IGL02024:Tbc1d31 APN 15 57919942 missense probably benign 0.10
IGL02501:Tbc1d31 APN 15 57937948 missense probably benign 0.11
IGL03133:Tbc1d31 APN 15 57942459 splice site probably benign
IGL03159:Tbc1d31 APN 15 57920048 critical splice donor site probably null
new_age UTSW 15 57951706 missense probably damaging 1.00
PIT4354001:Tbc1d31 UTSW 15 57967933 missense probably benign 0.09
R0239:Tbc1d31 UTSW 15 57940753 missense probably benign 0.14
R0239:Tbc1d31 UTSW 15 57940753 missense probably benign 0.14
R0375:Tbc1d31 UTSW 15 57955350 missense probably benign
R0478:Tbc1d31 UTSW 15 57932536 missense probably damaging 1.00
R0576:Tbc1d31 UTSW 15 57969724 missense possibly damaging 0.79
R1328:Tbc1d31 UTSW 15 57942463 splice site probably benign
R1454:Tbc1d31 UTSW 15 57951638 nonsense probably null
R1784:Tbc1d31 UTSW 15 57963920 missense possibly damaging 0.86
R1874:Tbc1d31 UTSW 15 57916110 missense probably benign 0.41
R1920:Tbc1d31 UTSW 15 57912364 missense probably damaging 1.00
R2111:Tbc1d31 UTSW 15 57932644 missense probably benign 0.05
R2174:Tbc1d31 UTSW 15 57951741 missense possibly damaging 0.95
R2205:Tbc1d31 UTSW 15 57953520 missense probably benign 0.11
R3683:Tbc1d31 UTSW 15 57951814 critical splice donor site probably null
R3825:Tbc1d31 UTSW 15 57916078 missense probably benign 0.43
R4407:Tbc1d31 UTSW 15 57920042 missense possibly damaging 0.93
R4627:Tbc1d31 UTSW 15 57967912 missense probably benign
R4792:Tbc1d31 UTSW 15 57940728 missense probably benign 0.03
R4804:Tbc1d31 UTSW 15 57951106 nonsense probably null
R4909:Tbc1d31 UTSW 15 57962265 critical splice donor site probably null
R5077:Tbc1d31 UTSW 15 57955401 missense probably benign 0.00
R5230:Tbc1d31 UTSW 15 57960919 missense probably damaging 0.99
R5436:Tbc1d31 UTSW 15 57952871 missense probably benign 0.04
R5652:Tbc1d31 UTSW 15 57951666 missense probably damaging 1.00
R5920:Tbc1d31 UTSW 15 57942558 missense probably benign 0.10
R6102:Tbc1d31 UTSW 15 57936093 missense probably damaging 1.00
R6176:Tbc1d31 UTSW 15 57952796 missense probably damaging 0.99
R6513:Tbc1d31 UTSW 15 57955382 missense probably damaging 1.00
R6778:Tbc1d31 UTSW 15 57938029 missense probably damaging 1.00
R7187:Tbc1d31 UTSW 15 57938063 missense possibly damaging 0.95
R7308:Tbc1d31 UTSW 15 57952816 missense probably damaging 1.00
R7359:Tbc1d31 UTSW 15 57916108 missense probably benign 0.00
R7453:Tbc1d31 UTSW 15 57950995 missense probably damaging 1.00
R7552:Tbc1d31 UTSW 15 57940740 missense probably benign
R7606:Tbc1d31 UTSW 15 57951670 missense probably damaging 1.00
R7739:Tbc1d31 UTSW 15 57936098 nonsense probably null
R7782:Tbc1d31 UTSW 15 57958368 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTTGTTGGCAAACAGCTGGG -3'
(R):5'- ACTGGAGAACGTCTTGTGTG -3'

Sequencing Primer
(F):5'- GCTTCGTGTGCATTAAGCC -3'
(R):5'- TGGAACCCTCGTGTGAGCTAG -3'
Posted On2018-08-29