Mutagenetix > Incidental Mutations

Incidental Mutation 'R6796:Insrr'

532999

Institutional Source

Beutler Lab

Gene Symbol

Insrr

Ensembl Gene

ENSMUSG00000005640

Gene Name

insulin receptor-related receptor

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.329) question?

Stock #

R6796 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87796951-87816101 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 87813566 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 1044 (R1044C)

Ref Sequence

ENSEMBL: ENSMUSP00000103208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]

AlphaFold

Q9WTL4

Predicted Effect

probably damaging
Transcript: ENSMUST00000029711
AA Change: R1044C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: R1044C

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	1.8e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	3.8e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000029714

SMART Domains

Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090981

SMART Domains

Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107582
AA Change: R1044C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: R1044C

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	7.7e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	1.6e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	G	13: 81,472,478	V3950A	probably damaging	Het
App	A	G	16: 85,120,567	I63T	probably damaging	Het
Bpifb4	A	T	2: 153,961,547	K381N	probably damaging	Het
Cdc45	C	T	16: 18,784,857	A529T	probably damaging	Het
Cdh18	T	A	15: 23,446,073	N536K	probably damaging	Het
Dpy19l1	C	A	9: 24,502,862	R90L	possibly damaging	Het
E2f3	A	G	13: 29,918,585	V231A	possibly damaging	Het
F930015N05Rik	A	T	11: 64,435,403		probably benign	Het
Fcer2a	T	C	8: 3,689,830	H47R	possibly damaging	Het
Hcar2	A	G	5: 123,865,267	S58P	probably benign	Het
Hivep3	A	G	4: 120,096,361	T625A	possibly damaging	Het
Itgax	C	T	7: 128,135,064	A336V	probably damaging	Het
Lin37	A	T	7: 30,556,916	V140E	probably damaging	Het
Malrd1	T	A	2: 15,869,784	I1341K	unknown	Het
Map4k5	T	C	12: 69,818,025	I561V	probably benign	Het
Mcc	A	G	18: 44,724,560	S163P	probably benign	Het
Nlrp12	T	C	7: 3,241,409	T158A	probably damaging	Het
Olfr1440	A	T	19: 12,394,928	I222F	probably damaging	Het
Olfr1475	A	G	19: 13,479,914	C95R	probably damaging	Het
Paqr5	C	T	9: 61,963,783	R171Q	probably damaging	Het
Pax8	A	T	2: 24,441,086	M200K	probably benign	Het
Plcd4	T	C	1: 74,562,070	S498P	probably benign	Het
Poglut1	T	C	16: 38,529,610	Y267C	probably damaging	Het
Pom121l2	T	C	13: 21,983,524	I655T	probably benign	Het
Proca1	G	T	11: 78,194,928	R19L	probably benign	Het
Prr30	A	G	14: 101,198,944	S61P	probably benign	Het
Ranbp17	T	C	11: 33,217,398	S1022G	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rpgrip1	A	G	14: 52,150,012	H1037R	probably damaging	Het
Rpl34	G	T	3: 130,729,277	T6K	probably damaging	Het
Scaper	T	C	9: 55,864,427	T402A	probably benign	Het
Selenow	A	T	7: 15,920,071	V52E	probably damaging	Het
Sept14	T	A	5: 129,697,758	I118L	probably benign	Het
Sis	A	T	3: 72,965,618	N62K	probably benign	Het
Sit1	A	T	4: 43,482,761	C133S	probably benign	Het
Susd3	ACC	AC	13: 49,237,565		probably null	Het
Svep1	A	G	4: 58,064,275	V3236A	probably benign	Het
Taf12	G	A	4: 132,289,414	V168I	possibly damaging	Het
Tas2r139	A	T	6: 42,141,592	R219S	probably damaging	Het
Tmc1	A	T	19: 20,799,036	V653D	probably damaging	Het
Utp23	T	A	15: 51,877,611	L30Q	probably damaging	Het

Other mutations in Insrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00718:Insrr	APN	3	87813674	critical splice donor site	probably null
IGL00801:Insrr	APN	3	87813808	missense	probably damaging	1.00
IGL01628:Insrr	APN	3	87800792	nonsense	probably null
IGL01755:Insrr	APN	3	87814186	missense	probably damaging	1.00
IGL02100:Insrr	APN	3	87811620	missense	probably damaging	1.00
IGL02261:Insrr	APN	3	87800722	missense	probably damaging	1.00
IGL02366:Insrr	APN	3	87809909	missense	possibly damaging	0.91
IGL02387:Insrr	APN	3	87813127	missense	probably damaging	1.00
IGL02478:Insrr	APN	3	87809412	missense	probably benign	0.14
IGL02550:Insrr	APN	3	87804498	missense	probably damaging	1.00
IGL02555:Insrr	APN	3	87813817	missense	probably damaging	0.99
IGL02673:Insrr	APN	3	87813061	missense	possibly damaging	0.95
IGL02724:Insrr	APN	3	87809572	missense	probably benign	0.31
IGL02798:Insrr	APN	3	87810517	missense	probably damaging	1.00
IGL02969:Insrr	APN	3	87814191	nonsense	probably null
IGL03073:Insrr	APN	3	87809938	splice site	probably benign
IGL03178:Insrr	APN	3	87802541	splice site	probably null
IGL03389:Insrr	APN	3	87808731	missense	probably damaging	1.00
IGL03399:Insrr	APN	3	87809331	missense	probably null	0.99
IGL02799:Insrr	UTSW	3	87813581	missense	probably damaging	1.00
R0011:Insrr	UTSW	3	87809616	missense	possibly damaging	0.86
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0357:Insrr	UTSW	3	87808646	splice site	probably null
R0501:Insrr	UTSW	3	87810684	missense	probably benign	0.12
R0504:Insrr	UTSW	3	87813156	missense	possibly damaging	0.69
R0522:Insrr	UTSW	3	87800872	missense	probably damaging	1.00
R0555:Insrr	UTSW	3	87814437	splice site	probably benign
R0558:Insrr	UTSW	3	87810981	missense	possibly damaging	0.77
R0599:Insrr	UTSW	3	87813133	missense	probably damaging	0.97
R1312:Insrr	UTSW	3	87800490	missense	probably damaging	1.00
R1694:Insrr	UTSW	3	87804062	missense	probably benign
R1785:Insrr	UTSW	3	87810572	splice site	probably null
R1786:Insrr	UTSW	3	87810572	splice site	probably null
R1892:Insrr	UTSW	3	87813877	missense	probably damaging	1.00
R1950:Insrr	UTSW	3	87814513	missense	probably damaging	1.00
R2080:Insrr	UTSW	3	87814291	missense	possibly damaging	0.79
R2094:Insrr	UTSW	3	87803181	missense	probably damaging	1.00
R2130:Insrr	UTSW	3	87810572	splice site	probably null
R2131:Insrr	UTSW	3	87810572	splice site	probably null
R2133:Insrr	UTSW	3	87810572	splice site	probably null
R2220:Insrr	UTSW	3	87809418	missense	probably damaging	1.00
R2259:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R2404:Insrr	UTSW	3	87802667	missense	possibly damaging	0.71
R4027:Insrr	UTSW	3	87809599	missense	probably benign
R4042:Insrr	UTSW	3	87813827	missense	probably damaging	1.00
R4510:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4511:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4571:Insrr	UTSW	3	87800887	missense	probably benign
R4870:Insrr	UTSW	3	87811604	missense	probably damaging	1.00
R5057:Insrr	UTSW	3	87815265	missense	probably benign	0.00
R5393:Insrr	UTSW	3	87810700	splice site	probably null
R5685:Insrr	UTSW	3	87800496	splice site	probably null
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6047:Insrr	UTSW	3	87804176	missense	probably damaging	1.00
R6276:Insrr	UTSW	3	87800519	nonsense	probably null
R6298:Insrr	UTSW	3	87812965	missense	probably damaging	1.00
R6726:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6727:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6728:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R7041:Insrr	UTSW	3	87815244	missense	probably damaging	1.00
R7169:Insrr	UTSW	3	87808594	missense	probably benign	0.15
R7270:Insrr	UTSW	3	87803133	missense	probably damaging	1.00
R7340:Insrr	UTSW	3	87814316	critical splice donor site	probably null
R7398:Insrr	UTSW	3	87808732	missense	probably damaging	1.00
R7473:Insrr	UTSW	3	87804531	splice site	probably null
R7815:Insrr	UTSW	3	87808695	missense	probably damaging	0.98
R8159:Insrr	UTSW	3	87800428	missense	probably damaging	1.00
R8289:Insrr	UTSW	3	87814194	missense	probably damaging	1.00
R8309:Insrr	UTSW	3	87810442	missense	probably benign	0.00
R8312:Insrr	UTSW	3	87800484	missense	possibly damaging	0.93
R8445:Insrr	UTSW	3	87813584	missense	probably damaging	1.00
R8917:Insrr	UTSW	3	87810969	missense	probably benign	0.00
R8960:Insrr	UTSW	3	87813079	missense	probably damaging	1.00
R8989:Insrr	UTSW	3	87815357	missense	probably damaging	0.96
R9015:Insrr	UTSW	3	87813603	missense	probably damaging	1.00
R9202:Insrr	UTSW	3	87813120	missense	probably damaging	1.00
R9251:Insrr	UTSW	3	87810084	missense	probably benign	0.08
R9327:Insrr	UTSW	3	87814297	missense	probably damaging	1.00
RF022:Insrr	UTSW	3	87804485	missense	possibly damaging	0.51
Z1177:Insrr	UTSW	3	87800827	missense	possibly damaging	0.91
Z1192:Insrr	UTSW	3	87802579	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGAGCACGTCATGATTATGG -3'
(R):5'- ATGTCACTGAGTGCAGGCTG -3'

Sequencing Primer
(F):5'- GCACGTCATGATTATGGTGATAATC -3'
(R):5'- GGTGAAGGACTTCCCCACAC -3'

Posted On

2018-08-29