Incidental Mutation 'R6796:Sit1'
ID 533001
Institutional Source Beutler Lab
Gene Symbol Sit1
Ensembl Gene ENSMUSG00000028460
Gene Name suppression inducing transmembrane adaptor 1
Synonyms Sit
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R6796 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 43482081-43483734 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43482761 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 133 (C133S)
Ref Sequence ENSEMBL: ENSMUSP00000030180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030180]
AlphaFold Q8C503
Predicted Effect probably benign
Transcript: ENSMUST00000030180
AA Change: C133S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000030180
Gene: ENSMUSG00000028460
AA Change: C133S

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit altered T-cell development, thymus hyperplasia, decreased lymph node cellularity and are more susceptible to develop experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,472,478 V3950A probably damaging Het
App A G 16: 85,120,567 I63T probably damaging Het
Bpifb4 A T 2: 153,961,547 K381N probably damaging Het
Cdc45 C T 16: 18,784,857 A529T probably damaging Het
Cdh18 T A 15: 23,446,073 N536K probably damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
E2f3 A G 13: 29,918,585 V231A possibly damaging Het
F930015N05Rik A T 11: 64,435,403 probably benign Het
Fcer2a T C 8: 3,689,830 H47R possibly damaging Het
Hcar2 A G 5: 123,865,267 S58P probably benign Het
Hivep3 A G 4: 120,096,361 T625A possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Itgax C T 7: 128,135,064 A336V probably damaging Het
Lin37 A T 7: 30,556,916 V140E probably damaging Het
Malrd1 T A 2: 15,869,784 I1341K unknown Het
Map4k5 T C 12: 69,818,025 I561V probably benign Het
Mcc A G 18: 44,724,560 S163P probably benign Het
Nlrp12 T C 7: 3,241,409 T158A probably damaging Het
Olfr1440 A T 19: 12,394,928 I222F probably damaging Het
Olfr1475 A G 19: 13,479,914 C95R probably damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pax8 A T 2: 24,441,086 M200K probably benign Het
Plcd4 T C 1: 74,562,070 S498P probably benign Het
Poglut1 T C 16: 38,529,610 Y267C probably damaging Het
Pom121l2 T C 13: 21,983,524 I655T probably benign Het
Proca1 G T 11: 78,194,928 R19L probably benign Het
Prr30 A G 14: 101,198,944 S61P probably benign Het
Ranbp17 T C 11: 33,217,398 S1022G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpgrip1 A G 14: 52,150,012 H1037R probably damaging Het
Rpl34 G T 3: 130,729,277 T6K probably damaging Het
Scaper T C 9: 55,864,427 T402A probably benign Het
Selenow A T 7: 15,920,071 V52E probably damaging Het
Sept14 T A 5: 129,697,758 I118L probably benign Het
Sis A T 3: 72,965,618 N62K probably benign Het
Susd3 ACC AC 13: 49,237,565 probably null Het
Svep1 A G 4: 58,064,275 V3236A probably benign Het
Taf12 G A 4: 132,289,414 V168I possibly damaging Het
Tas2r139 A T 6: 42,141,592 R219S probably damaging Het
Tmc1 A T 19: 20,799,036 V653D probably damaging Het
Utp23 T A 15: 51,877,611 L30Q probably damaging Het
Other mutations in Sit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02859:Sit1 APN 4 43482831 missense probably benign 0.01
R0324:Sit1 UTSW 4 43482815 nonsense probably null
R0483:Sit1 UTSW 4 43482991 missense possibly damaging 0.52
R2679:Sit1 UTSW 4 43483157 missense probably damaging 1.00
R2885:Sit1 UTSW 4 43483314 missense possibly damaging 0.93
R2886:Sit1 UTSW 4 43483314 missense possibly damaging 0.93
R5644:Sit1 UTSW 4 43483562 missense probably benign 0.38
R6154:Sit1 UTSW 4 43482981 missense probably benign 0.44
R6264:Sit1 UTSW 4 43482651 missense possibly damaging 0.94
R6694:Sit1 UTSW 4 43483311 missense probably damaging 0.97
R8345:Sit1 UTSW 4 43483168 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AATGCCCTGGAGGTGGTTAG -3'
(R):5'- TCGGCTGTCTCAAGAACCAAG -3'

Sequencing Primer
(F):5'- TGACCCAGTAGCTGAGCCATG -3'
(R):5'- GCTGTCTCAAGAACCAAGGTCAG -3'
Posted On 2018-08-29