Incidental Mutation 'R6796:Tas2r139'
ID533007
Institutional Source Beutler Lab
Gene Symbol Tas2r139
Ensembl Gene ENSMUSG00000047102
Gene Nametaste receptor, type 2, member 139
Synonymsmt2r34, Tas2r39
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6796 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42140936-42141895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42141592 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 219 (R219S)
Ref Sequence ENSEMBL: ENSMUSP00000062919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057686]
Predicted Effect probably damaging
Transcript: ENSMUST00000057686
AA Change: R219S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062919
Gene: ENSMUSG00000047102
AA Change: R219S

DomainStartEndE-ValueType
Pfam:TAS2R 13 311 2.5e-64 PFAM
Meta Mutation Damage Score 0.6953 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bitter taste receptor that detects green tea catechins, soy isoflavones, and theaflavins. The encoded protein is gustducin-linked and may activate alpha gustducin. This gene is intronless. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,472,478 V3950A probably damaging Het
App A G 16: 85,120,567 I63T probably damaging Het
Bpifb4 A T 2: 153,961,547 K381N probably damaging Het
Cdc45 C T 16: 18,784,857 A529T probably damaging Het
Cdh18 T A 15: 23,446,073 N536K probably damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
E2f3 A G 13: 29,918,585 V231A possibly damaging Het
F930015N05Rik A T 11: 64,435,403 probably benign Het
Fcer2a T C 8: 3,689,830 H47R possibly damaging Het
Hcar2 A G 5: 123,865,267 S58P probably benign Het
Hivep3 A G 4: 120,096,361 T625A possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Itgax C T 7: 128,135,064 A336V probably damaging Het
Lin37 A T 7: 30,556,916 V140E probably damaging Het
Malrd1 T A 2: 15,869,784 I1341K unknown Het
Map4k5 T C 12: 69,818,025 I561V probably benign Het
Mcc A G 18: 44,724,560 S163P probably benign Het
Nlrp12 T C 7: 3,241,409 T158A probably damaging Het
Olfr1440 A T 19: 12,394,928 I222F probably damaging Het
Olfr1475 A G 19: 13,479,914 C95R probably damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pax8 A T 2: 24,441,086 M200K probably benign Het
Plcd4 T C 1: 74,562,070 S498P probably benign Het
Poglut1 T C 16: 38,529,610 Y267C probably damaging Het
Pom121l2 T C 13: 21,983,524 I655T probably benign Het
Proca1 G T 11: 78,194,928 R19L probably benign Het
Prr30 A G 14: 101,198,944 S61P probably benign Het
Ranbp17 T C 11: 33,217,398 S1022G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpgrip1 A G 14: 52,150,012 H1037R probably damaging Het
Rpl34 G T 3: 130,729,277 T6K probably damaging Het
Scaper T C 9: 55,864,427 T402A probably benign Het
Selenow A T 7: 15,920,071 V52E probably damaging Het
Sept14 T A 5: 129,697,758 I118L probably benign Het
Sis A T 3: 72,965,618 N62K probably benign Het
Sit1 A T 4: 43,482,761 C133S probably benign Het
Susd3 ACC AC 13: 49,237,565 probably null Het
Svep1 A G 4: 58,064,275 V3236A probably benign Het
Taf12 G A 4: 132,289,414 V168I possibly damaging Het
Tmc1 A T 19: 20,799,036 V653D probably damaging Het
Utp23 T A 15: 51,877,611 L30Q probably damaging Het
Other mutations in Tas2r139
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Tas2r139 APN 6 42141121 missense probably damaging 1.00
IGL01593:Tas2r139 APN 6 42140957 missense probably benign 0.01
IGL01835:Tas2r139 APN 6 42141432 missense probably benign 0.21
IGL02990:Tas2r139 APN 6 42141104 missense probably damaging 1.00
R0517:Tas2r139 UTSW 6 42141491 missense probably damaging 0.98
R1106:Tas2r139 UTSW 6 42141545 missense probably benign 0.36
R1352:Tas2r139 UTSW 6 42140940 missense probably benign 0.28
R4352:Tas2r139 UTSW 6 42141755 missense probably damaging 1.00
R4632:Tas2r139 UTSW 6 42141498 missense probably damaging 1.00
R4785:Tas2r139 UTSW 6 42141284 missense probably damaging 1.00
R4947:Tas2r139 UTSW 6 42141566 missense possibly damaging 0.82
R5888:Tas2r139 UTSW 6 42141496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGCACAAGTTCACTGTG -3'
(R):5'- AAAACTGAATGGCCAGCTGG -3'

Sequencing Primer
(F):5'- TTCACTGTGAACAACAACAATTCTC -3'
(R):5'- CTGAATGGCCAGCTGGGTAGAC -3'
Posted On2018-08-29