Incidental Mutation 'R6796:Itgax'
ID533011
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Nameintegrin alpha X
SynonymsCd11c, CD11C (p150) alpha polypeptide
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6796 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location128129547-128150657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128135064 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 336 (A336V)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053] [ENSMUST00000205460]
Predicted Effect probably damaging
Transcript: ENSMUST00000033053
AA Change: A336V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: A336V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205460
Meta Mutation Damage Score 0.2375 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,472,478 V3950A probably damaging Het
App A G 16: 85,120,567 I63T probably damaging Het
Bpifb4 A T 2: 153,961,547 K381N probably damaging Het
Cdc45 C T 16: 18,784,857 A529T probably damaging Het
Cdh18 T A 15: 23,446,073 N536K probably damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
E2f3 A G 13: 29,918,585 V231A possibly damaging Het
F930015N05Rik A T 11: 64,435,403 probably benign Het
Fcer2a T C 8: 3,689,830 H47R possibly damaging Het
Hcar2 A G 5: 123,865,267 S58P probably benign Het
Hivep3 A G 4: 120,096,361 T625A possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Lin37 A T 7: 30,556,916 V140E probably damaging Het
Malrd1 T A 2: 15,869,784 I1341K unknown Het
Map4k5 T C 12: 69,818,025 I561V probably benign Het
Mcc A G 18: 44,724,560 S163P probably benign Het
Nlrp12 T C 7: 3,241,409 T158A probably damaging Het
Olfr1440 A T 19: 12,394,928 I222F probably damaging Het
Olfr1475 A G 19: 13,479,914 C95R probably damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pax8 A T 2: 24,441,086 M200K probably benign Het
Plcd4 T C 1: 74,562,070 S498P probably benign Het
Poglut1 T C 16: 38,529,610 Y267C probably damaging Het
Pom121l2 T C 13: 21,983,524 I655T probably benign Het
Proca1 G T 11: 78,194,928 R19L probably benign Het
Prr30 A G 14: 101,198,944 S61P probably benign Het
Ranbp17 T C 11: 33,217,398 S1022G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpgrip1 A G 14: 52,150,012 H1037R probably damaging Het
Rpl34 G T 3: 130,729,277 T6K probably damaging Het
Scaper T C 9: 55,864,427 T402A probably benign Het
Selenow A T 7: 15,920,071 V52E probably damaging Het
Sept14 T A 5: 129,697,758 I118L probably benign Het
Sis A T 3: 72,965,618 N62K probably benign Het
Sit1 A T 4: 43,482,761 C133S probably benign Het
Susd3 ACC AC 13: 49,237,565 probably null Het
Svep1 A G 4: 58,064,275 V3236A probably benign Het
Taf12 G A 4: 132,289,414 V168I possibly damaging Het
Tas2r139 A T 6: 42,141,592 R219S probably damaging Het
Tmc1 A T 19: 20,799,036 V653D probably damaging Het
Utp23 T A 15: 51,877,611 L30Q probably damaging Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense possibly damaging 0.69
IGL01155:Itgax APN 7 128145035 missense probably benign 0.00
IGL01461:Itgax APN 7 128135018 missense probably damaging 1.00
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice site probably null
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.89
IGL02969:Itgax APN 7 128149123 missense probably benign
IGL03406:Itgax APN 7 128149198 missense possibly damaging 0.93
Adendritic UTSW 7 128148572 nonsense probably null
PIT4651001:Itgax UTSW 7 128149110 missense probably benign 0.11
R0366:Itgax UTSW 7 128149089 splice site probably benign
R0763:Itgax UTSW 7 128147940 splice site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R1659:Itgax UTSW 7 128130891 missense probably benign 0.15
R2019:Itgax UTSW 7 128148526 missense probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3027:Itgax UTSW 7 128148572 nonsense probably null
R3846:Itgax UTSW 7 128133767 missense probably damaging 1.00
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4021:Itgax UTSW 7 128133139 critical splice donor site probably null
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R4923:Itgax UTSW 7 128148528 missense probably benign
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5725:Itgax UTSW 7 128147861 missense possibly damaging 0.63
R5733:Itgax UTSW 7 128140475 missense probably damaging 0.99
R5750:Itgax UTSW 7 128144706 missense probably benign 0.32
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
R6004:Itgax UTSW 7 128131452 missense probably damaging 0.96
R6168:Itgax UTSW 7 128133097 missense probably damaging 0.99
R6212:Itgax UTSW 7 128130332 missense possibly damaging 0.52
R6212:Itgax UTSW 7 128147853 missense probably benign 0.16
R6480:Itgax UTSW 7 128148599 missense probably benign 0.12
R6484:Itgax UTSW 7 128133718 missense probably benign 0.13
R6844:Itgax UTSW 7 128147934 splice site probably null
R7287:Itgax UTSW 7 128148505 missense probably damaging 1.00
R7365:Itgax UTSW 7 128135309 missense probably damaging 1.00
R7421:Itgax UTSW 7 128140432 missense probably damaging 1.00
R7599:Itgax UTSW 7 128148090 missense probably damaging 0.99
R7710:Itgax UTSW 7 128135856 missense probably benign 0.04
X0061:Itgax UTSW 7 128129607 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCGAGCAGTAACATGACATACAGG -3'
(R):5'- AGACGACATTTCCCAGGTCC -3'

Sequencing Primer
(F):5'- TGACATACAGGCCTAGGAGAACTTC -3'
(R):5'- CAGGGAGGCTTCTTGGGAGAATC -3'
Posted On2018-08-29