Incidental Mutation 'R6796:Fcer2a'
ID533012
Institutional Source Beutler Lab
Gene Symbol Fcer2a
Ensembl Gene ENSMUSG00000005540
Gene NameFc receptor, IgE, low affinity II, alpha polypeptide
SynonymsLy-42, FC epsilon RII, CD23, Fce2, low-affinity IgE receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6796 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location3681737-3694175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3689830 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 47 (H47R)
Ref Sequence ENSEMBL: ENSMUSP00000146647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005678] [ENSMUST00000207463] [ENSMUST00000207635] [ENSMUST00000208145] [ENSMUST00000208438] [ENSMUST00000208492] [ENSMUST00000208603]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005678
AA Change: H48R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005678
Gene: ENSMUSG00000005540
AA Change: H48R

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
coiled coil region 80 150 N/A INTRINSIC
CLECT 186 306 2.11e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207463
AA Change: D8G

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000207635
AA Change: H21R

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208145
AA Change: H47R

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000208438
AA Change: H47R

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208492
AA Change: H47R

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000208603
AA Change: H47R

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0805 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for mutations in this gene are essentially normal although IgE levels or IgE mediated responses may be abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,472,478 V3950A probably damaging Het
App A G 16: 85,120,567 I63T probably damaging Het
Bpifb4 A T 2: 153,961,547 K381N probably damaging Het
Cdc45 C T 16: 18,784,857 A529T probably damaging Het
Cdh18 T A 15: 23,446,073 N536K probably damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
E2f3 A G 13: 29,918,585 V231A possibly damaging Het
F930015N05Rik A T 11: 64,435,403 probably benign Het
Hcar2 A G 5: 123,865,267 S58P probably benign Het
Hivep3 A G 4: 120,096,361 T625A possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Itgax C T 7: 128,135,064 A336V probably damaging Het
Lin37 A T 7: 30,556,916 V140E probably damaging Het
Malrd1 T A 2: 15,869,784 I1341K unknown Het
Map4k5 T C 12: 69,818,025 I561V probably benign Het
Mcc A G 18: 44,724,560 S163P probably benign Het
Nlrp12 T C 7: 3,241,409 T158A probably damaging Het
Olfr1440 A T 19: 12,394,928 I222F probably damaging Het
Olfr1475 A G 19: 13,479,914 C95R probably damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pax8 A T 2: 24,441,086 M200K probably benign Het
Plcd4 T C 1: 74,562,070 S498P probably benign Het
Poglut1 T C 16: 38,529,610 Y267C probably damaging Het
Pom121l2 T C 13: 21,983,524 I655T probably benign Het
Proca1 G T 11: 78,194,928 R19L probably benign Het
Prr30 A G 14: 101,198,944 S61P probably benign Het
Ranbp17 T C 11: 33,217,398 S1022G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpgrip1 A G 14: 52,150,012 H1037R probably damaging Het
Rpl34 G T 3: 130,729,277 T6K probably damaging Het
Scaper T C 9: 55,864,427 T402A probably benign Het
Selenow A T 7: 15,920,071 V52E probably damaging Het
Sept14 T A 5: 129,697,758 I118L probably benign Het
Sis A T 3: 72,965,618 N62K probably benign Het
Sit1 A T 4: 43,482,761 C133S probably benign Het
Susd3 ACC AC 13: 49,237,565 probably null Het
Svep1 A G 4: 58,064,275 V3236A probably benign Het
Taf12 G A 4: 132,289,414 V168I possibly damaging Het
Tas2r139 A T 6: 42,141,592 R219S probably damaging Het
Tmc1 A T 19: 20,799,036 V653D probably damaging Het
Utp23 T A 15: 51,877,611 L30Q probably damaging Het
Other mutations in Fcer2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Fcer2a APN 8 3688842 missense possibly damaging 0.94
IGL01458:Fcer2a APN 8 3688151 missense probably benign 0.45
IGL01545:Fcer2a APN 8 3683598 nonsense probably null
IGL01994:Fcer2a APN 8 3688302 missense possibly damaging 0.94
IGL03340:Fcer2a APN 8 3688310 missense possibly damaging 0.75
anemone UTSW 8 3688796 critical splice donor site probably null
R0058:Fcer2a UTSW 8 3688111 splice site probably benign
R0058:Fcer2a UTSW 8 3688111 splice site probably benign
R0241:Fcer2a UTSW 8 3688796 critical splice donor site probably null
R0241:Fcer2a UTSW 8 3688796 critical splice donor site probably null
R0276:Fcer2a UTSW 8 3689811 missense possibly damaging 0.89
R1530:Fcer2a UTSW 8 3682976 missense probably damaging 0.98
R2202:Fcer2a UTSW 8 3688557 missense possibly damaging 0.72
R4133:Fcer2a UTSW 8 3691130 missense possibly damaging 0.60
R4249:Fcer2a UTSW 8 3688831 missense probably benign 0.00
R4273:Fcer2a UTSW 8 3682848 missense possibly damaging 0.81
R4506:Fcer2a UTSW 8 3688603 splice site probably null
R6861:Fcer2a UTSW 8 3682910 missense probably damaging 0.98
R7421:Fcer2a UTSW 8 3690335 missense probably benign
R7795:Fcer2a UTSW 8 3682910 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAAGTTTTCTACTGAGATAGAGGC -3'
(R):5'- TCTGTGGCGTAAGGACATCC -3'

Sequencing Primer
(F):5'- AGATAGAGGCTATCCATTGGTTCCC -3'
(R):5'- CGTAAGGACATCCGCAGC -3'
Posted On2018-08-29