Incidental Mutation 'R6796:Cdh18'
ID533027
Institutional Source Beutler Lab
Gene Symbol Cdh18
Ensembl Gene ENSMUSG00000040420
Gene Namecadherin 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R6796 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location22549022-23474418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23446073 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 536 (N536K)
Ref Sequence ENSEMBL: ENSMUSP00000128643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164787] [ENSMUST00000165614] [ENSMUST00000167623] [ENSMUST00000226693]
Predicted Effect probably damaging
Transcript: ENSMUST00000164787
AA Change: N536K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130851
Gene: ENSMUSG00000040420
AA Change: N536K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
CA 509 596 3.7e-5 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 6.8e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165614
AA Change: N536K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128643
Gene: ENSMUSG00000040420
AA Change: N536K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167623
SMART Domains Protein: ENSMUSP00000128011
Gene: ENSMUSG00000040420

DomainStartEndE-ValueType
CA 22 103 4.24e-14 SMART
CA 127 212 1.37e-31 SMART
CA 236 328 2.76e-13 SMART
CA 351 414 4.15e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226693
AA Change: N536K
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,472,478 V3950A probably damaging Het
App A G 16: 85,120,567 I63T probably damaging Het
Bpifb4 A T 2: 153,961,547 K381N probably damaging Het
Cdc45 C T 16: 18,784,857 A529T probably damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
E2f3 A G 13: 29,918,585 V231A possibly damaging Het
F930015N05Rik A T 11: 64,435,403 probably benign Het
Fcer2a T C 8: 3,689,830 H47R possibly damaging Het
Hcar2 A G 5: 123,865,267 S58P probably benign Het
Hivep3 A G 4: 120,096,361 T625A possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Itgax C T 7: 128,135,064 A336V probably damaging Het
Lin37 A T 7: 30,556,916 V140E probably damaging Het
Malrd1 T A 2: 15,869,784 I1341K unknown Het
Map4k5 T C 12: 69,818,025 I561V probably benign Het
Mcc A G 18: 44,724,560 S163P probably benign Het
Nlrp12 T C 7: 3,241,409 T158A probably damaging Het
Olfr1440 A T 19: 12,394,928 I222F probably damaging Het
Olfr1475 A G 19: 13,479,914 C95R probably damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pax8 A T 2: 24,441,086 M200K probably benign Het
Plcd4 T C 1: 74,562,070 S498P probably benign Het
Poglut1 T C 16: 38,529,610 Y267C probably damaging Het
Pom121l2 T C 13: 21,983,524 I655T probably benign Het
Proca1 G T 11: 78,194,928 R19L probably benign Het
Prr30 A G 14: 101,198,944 S61P probably benign Het
Ranbp17 T C 11: 33,217,398 S1022G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpgrip1 A G 14: 52,150,012 H1037R probably damaging Het
Rpl34 G T 3: 130,729,277 T6K probably damaging Het
Scaper T C 9: 55,864,427 T402A probably benign Het
Selenow A T 7: 15,920,071 V52E probably damaging Het
Sept14 T A 5: 129,697,758 I118L probably benign Het
Sis A T 3: 72,965,618 N62K probably benign Het
Sit1 A T 4: 43,482,761 C133S probably benign Het
Susd3 ACC AC 13: 49,237,565 probably null Het
Svep1 A G 4: 58,064,275 V3236A probably benign Het
Taf12 G A 4: 132,289,414 V168I possibly damaging Het
Tas2r139 A T 6: 42,141,592 R219S probably damaging Het
Tmc1 A T 19: 20,799,036 V653D probably damaging Het
Utp23 T A 15: 51,877,611 L30Q probably damaging Het
Other mutations in Cdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Cdh18 APN 15 23173796 missense probably damaging 0.97
IGL01663:Cdh18 APN 15 23445991 missense possibly damaging 0.92
IGL01758:Cdh18 APN 15 23474183 missense probably benign 0.20
IGL02192:Cdh18 APN 15 23460316 missense probably damaging 1.00
IGL02448:Cdh18 APN 15 23173789 missense probably benign 0.00
IGL02717:Cdh18 APN 15 23410715 nonsense probably null
IGL03241:Cdh18 APN 15 23226933 missense probably benign 0.19
IGL03268:Cdh18 APN 15 23366867 missense probably damaging 1.00
IGL03307:Cdh18 APN 15 23226786 missense probably damaging 1.00
R0316:Cdh18 UTSW 15 23366913 missense probably damaging 1.00
R0462:Cdh18 UTSW 15 23366885 missense probably damaging 1.00
R0607:Cdh18 UTSW 15 23410790 missense probably benign 0.01
R0761:Cdh18 UTSW 15 23226752 missense possibly damaging 0.87
R0973:Cdh18 UTSW 15 23473995 missense probably damaging 0.99
R1110:Cdh18 UTSW 15 23474317 missense probably benign 0.00
R1550:Cdh18 UTSW 15 23436548 missense probably damaging 1.00
R1656:Cdh18 UTSW 15 23474399 missense probably benign 0.38
R1682:Cdh18 UTSW 15 23400585 missense probably benign 0.05
R1770:Cdh18 UTSW 15 23474401 missense probably benign
R1829:Cdh18 UTSW 15 23173852 missense probably damaging 1.00
R2253:Cdh18 UTSW 15 23410805 missense probably benign 0.00
R2435:Cdh18 UTSW 15 23367008 missense probably damaging 1.00
R3914:Cdh18 UTSW 15 23410685 missense probably damaging 1.00
R3964:Cdh18 UTSW 15 23474101 missense probably benign
R4002:Cdh18 UTSW 15 23382962 missense possibly damaging 0.48
R4291:Cdh18 UTSW 15 22714551 intron probably benign
R4581:Cdh18 UTSW 15 23226783 missense probably damaging 1.00
R4604:Cdh18 UTSW 15 23474368 missense probably benign 0.05
R4625:Cdh18 UTSW 15 22714042 intron probably benign
R4786:Cdh18 UTSW 15 23410787 missense probably null 1.00
R4811:Cdh18 UTSW 15 23226791 missense probably benign 0.30
R5023:Cdh18 UTSW 15 23259666 missense probably damaging 1.00
R5094:Cdh18 UTSW 15 22714539 intron probably benign
R5278:Cdh18 UTSW 15 23474158 missense probably benign 0.04
R5416:Cdh18 UTSW 15 23226723 missense probably damaging 1.00
R5503:Cdh18 UTSW 15 23436534 missense probably damaging 0.96
R5617:Cdh18 UTSW 15 23226768 missense probably damaging 0.97
R5982:Cdh18 UTSW 15 23474216 missense possibly damaging 0.89
R6240:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6475:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6649:Cdh18 UTSW 15 23436534 missense possibly damaging 0.87
R6700:Cdh18 UTSW 15 23474105 missense probably benign
R6718:Cdh18 UTSW 15 23226749 missense probably benign 0.15
R7330:Cdh18 UTSW 15 23226950 missense possibly damaging 0.46
R7429:Cdh18 UTSW 15 23366856 missense possibly damaging 0.89
R7477:Cdh18 UTSW 15 23410725 missense probably benign
R7516:Cdh18 UTSW 15 23259598 splice site probably null
R7519:Cdh18 UTSW 15 23474212 missense possibly damaging 0.68
R7575:Cdh18 UTSW 15 23400597 nonsense probably null
R7618:Cdh18 UTSW 15 23366970 missense probably damaging 1.00
R7844:Cdh18 UTSW 15 23410787 missense probably damaging 1.00
R7870:Cdh18 UTSW 15 23474327 missense possibly damaging 0.94
R8288:Cdh18 UTSW 15 23445987 missense probably damaging 1.00
R8420:Cdh18 UTSW 15 23474052 missense possibly damaging 0.94
R8430:Cdh18 UTSW 15 23226684 missense probably damaging 1.00
Z1189:Cdh18 UTSW 15 23474283 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGTACCATGATGTAATAAAGCGTGG -3'
(R):5'- TGCTTCTGAGTAAATCCAATCACTG -3'

Sequencing Primer
(F):5'- TGTCTTTTCCTAAAACCAATTGGAG -3'
(R):5'- TCACTGTTATTTGTACATATGGCTC -3'
Posted On2018-08-29