Incidental Mutation 'R6796:Mcc'
ID533032
Institutional Source Beutler Lab
Gene Symbol Mcc
Ensembl Gene ENSMUSG00000071856
Gene Namemutated in colorectal cancers
SynonymsD18Ertd451e
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001085373.1, NM_001085374.1; MGI:96930

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6796 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location44425060-44812182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44724560 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 163 (S163P)
Ref Sequence ENSEMBL: ENSMUSP00000087318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089874]
Predicted Effect probably benign
Transcript: ENSMUST00000089874
AA Change: S163P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856
AA Change: S163P

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
EFh 24 52 1.36e-3 SMART
EFh 57 85 7.36e0 SMART
coiled coil region 196 308 N/A INTRINSIC
coiled coil region 395 466 N/A INTRINSIC
low complexity region 488 493 N/A INTRINSIC
low complexity region 512 517 N/A INTRINSIC
low complexity region 523 537 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 577 641 2.6e-32 PFAM
low complexity region 715 731 N/A INTRINSIC
coiled coil region 738 834 N/A INTRINSIC
low complexity region 853 863 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 906 972 1.1e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (41/42)
MGI Phenotype Strain: 3889488; 4335844
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate colorectal tumor suppressor gene that is thought to negatively regulate cell cycle progression. The orthologous gene in the mouse expresses a phosphoprotein associated with the plasma membrane and membrane organelles, and overexpression of the mouse protein inhibits entry into S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for hypomorphic or null mutations are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(29) : Targeted(2) Gene trapped(27)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,472,478 V3950A probably damaging Het
App A G 16: 85,120,567 I63T probably damaging Het
Bpifb4 A T 2: 153,961,547 K381N probably damaging Het
Cdc45 C T 16: 18,784,857 A529T probably damaging Het
Cdh18 T A 15: 23,446,073 N536K probably damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
E2f3 A G 13: 29,918,585 V231A possibly damaging Het
F930015N05Rik A T 11: 64,435,403 probably benign Het
Fcer2a T C 8: 3,689,830 H47R possibly damaging Het
Hcar2 A G 5: 123,865,267 S58P probably benign Het
Hivep3 A G 4: 120,096,361 T625A possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Itgax C T 7: 128,135,064 A336V probably damaging Het
Lin37 A T 7: 30,556,916 V140E probably damaging Het
Malrd1 T A 2: 15,869,784 I1341K unknown Het
Map4k5 T C 12: 69,818,025 I561V probably benign Het
Nlrp12 T C 7: 3,241,409 T158A probably damaging Het
Olfr1440 A T 19: 12,394,928 I222F probably damaging Het
Olfr1475 A G 19: 13,479,914 C95R probably damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pax8 A T 2: 24,441,086 M200K probably benign Het
Plcd4 T C 1: 74,562,070 S498P probably benign Het
Poglut1 T C 16: 38,529,610 Y267C probably damaging Het
Pom121l2 T C 13: 21,983,524 I655T probably benign Het
Proca1 G T 11: 78,194,928 R19L probably benign Het
Prr30 A G 14: 101,198,944 S61P probably benign Het
Ranbp17 T C 11: 33,217,398 S1022G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpgrip1 A G 14: 52,150,012 H1037R probably damaging Het
Rpl34 G T 3: 130,729,277 T6K probably damaging Het
Scaper T C 9: 55,864,427 T402A probably benign Het
Selenow A T 7: 15,920,071 V52E probably damaging Het
Sept14 T A 5: 129,697,758 I118L probably benign Het
Sis A T 3: 72,965,618 N62K probably benign Het
Sit1 A T 4: 43,482,761 C133S probably benign Het
Susd3 ACC AC 13: 49,237,565 probably null Het
Svep1 A G 4: 58,064,275 V3236A probably benign Het
Taf12 G A 4: 132,289,414 V168I possibly damaging Het
Tas2r139 A T 6: 42,141,592 R219S probably damaging Het
Tmc1 A T 19: 20,799,036 V653D probably damaging Het
Utp23 T A 15: 51,877,611 L30Q probably damaging Het
Other mutations in Mcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Mcc APN 18 44449216 missense possibly damaging 0.93
IGL00981:Mcc APN 18 44449349 missense probably damaging 0.99
IGL00985:Mcc APN 18 44491239 missense probably damaging 1.00
IGL01674:Mcc APN 18 44491156 missense probably benign 0.10
IGL01862:Mcc APN 18 44759296 missense probably benign 0.00
IGL01935:Mcc APN 18 44519516 critical splice donor site probably null
IGL02168:Mcc APN 18 44449299 missense probably damaging 0.97
IGL02449:Mcc APN 18 44459958 missense probably benign 0.10
IGL02613:Mcc APN 18 44429954 missense probably damaging 1.00
IGL02709:Mcc APN 18 44445810 missense possibly damaging 0.73
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0021:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0022:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0063:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0064:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0217:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0218:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0243:Mcc UTSW 18 44759299 missense probably benign
R0373:Mcc UTSW 18 44475222 missense probably benign 0.01
R0564:Mcc UTSW 18 44468507 missense probably damaging 1.00
R0604:Mcc UTSW 18 44473756 missense probably damaging 1.00
R0691:Mcc UTSW 18 44445860 missense possibly damaging 0.67
R0965:Mcc UTSW 18 44724526 missense probably benign 0.41
R1015:Mcc UTSW 18 44724669 missense probably benign
R1186:Mcc UTSW 18 44759403 missense probably benign
R1215:Mcc UTSW 18 44468494 missense possibly damaging 0.93
R1878:Mcc UTSW 18 44468400 missense possibly damaging 0.69
R1990:Mcc UTSW 18 44491315 nonsense probably null
R1991:Mcc UTSW 18 44491315 nonsense probably null
R1992:Mcc UTSW 18 44491315 nonsense probably null
R2186:Mcc UTSW 18 44812078 missense possibly damaging 0.71
R2189:Mcc UTSW 18 44534230 missense possibly damaging 0.93
R2258:Mcc UTSW 18 44475136 missense probably damaging 1.00
R2267:Mcc UTSW 18 44519541 missense probably damaging 0.99
R2310:Mcc UTSW 18 44431366 missense probably damaging 1.00
R2343:Mcc UTSW 18 44459797 critical splice donor site probably null
R2377:Mcc UTSW 18 44519549 missense probably damaging 1.00
R3110:Mcc UTSW 18 44449263 missense probably damaging 1.00
R3112:Mcc UTSW 18 44449263 missense probably damaging 1.00
R4135:Mcc UTSW 18 44724640 missense probably benign 0.03
R4404:Mcc UTSW 18 44759298 missense probably benign
R4600:Mcc UTSW 18 44519520 missense probably damaging 1.00
R4606:Mcc UTSW 18 44468421 missense probably damaging 0.96
R4721:Mcc UTSW 18 44519556 missense probably damaging 1.00
R5858:Mcc UTSW 18 44510141 missense probably damaging 0.98
R5997:Mcc UTSW 18 44449321 missense probably damaging 1.00
R6482:Mcc UTSW 18 44445864 missense possibly damaging 0.94
R6502:Mcc UTSW 18 44468390 nonsense probably null
R6502:Mcc UTSW 18 44468391 missense probably damaging 1.00
R6518:Mcc UTSW 18 44661811 start gained probably benign
R6846:Mcc UTSW 18 44473640 missense possibly damaging 0.63
R6879:Mcc UTSW 18 44812112 missense unknown
R7147:Mcc UTSW 18 44493513 missense probably damaging 0.99
R7475:Mcc UTSW 18 44476236 missense probably damaging 0.98
R7515:Mcc UTSW 18 44493432 missense probably benign 0.02
R7608:Mcc UTSW 18 44491227 missense possibly damaging 0.83
X0010:Mcc UTSW 18 44429957 missense possibly damaging 0.94
Z1177:Mcc UTSW 18 44491246 missense not run
Predicted Primers PCR Primer
(F):5'- AAGTGGCACAACATTTAGCTCAAC -3'
(R):5'- TGACCACCCACAGGCTAATG -3'

Sequencing Primer
(F):5'- TACTCAGCATACCCCTTGGAG -3'
(R):5'- CCACAGGCTAATGAAAGAAATGTC -3'
Posted On2018-08-29