Mutagenetix > Incidental Mutation

Incidental Mutation 'R6796:Tmc1'

533035

Institutional Source

Beutler Lab

Gene Symbol

Tmc1

Ensembl Gene

ENSMUSG00000024749

Gene Name

transmembrane channel-like gene family 1

Synonyms

4933416G09Rik, Beethoven, Bth

MMRRC Submission

044909-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.291) question?

Stock #

R6796 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20783458-20954202 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20799036 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 653 (V653D)

Ref Sequence

ENSEMBL: ENSMUSP00000040859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039500]

AlphaFold

Q8R4P5

Predicted Effect

probably damaging
Transcript: ENSMUST00000039500
AA Change: V653D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: V653D

Domain	Start	End	E-Value	Type
SCOP:d1eq1a_	2	95	3e-3	SMART
low complexity region	129	150	N/A	INTRINSIC
transmembrane domain	184	206	N/A	INTRINSIC
transmembrane domain	265	287	N/A	INTRINSIC
low complexity region	295	302	N/A	INTRINSIC
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	431	453	N/A	INTRINSIC
Pfam:TMC	512	627	2.6e-36	PFAM
transmembrane domain	632	654	N/A	INTRINSIC
transmembrane domain	693	715	N/A	INTRINSIC
low complexity region	738	754	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	G	13: 81,472,478	V3950A	probably damaging	Het
App	A	G	16: 85,120,567	I63T	probably damaging	Het
Bpifb4	A	T	2: 153,961,547	K381N	probably damaging	Het
Cdc45	C	T	16: 18,784,857	A529T	probably damaging	Het
Cdh18	T	A	15: 23,446,073	N536K	probably damaging	Het
Dpy19l1	C	A	9: 24,502,862	R90L	possibly damaging	Het
E2f3	A	G	13: 29,918,585	V231A	possibly damaging	Het
F930015N05Rik	A	T	11: 64,435,403		probably benign	Het
Fcer2a	T	C	8: 3,689,830	H47R	possibly damaging	Het
Hcar2	A	G	5: 123,865,267	S58P	probably benign	Het
Hivep3	A	G	4: 120,096,361	T625A	possibly damaging	Het
Insrr	C	T	3: 87,813,566	R1044C	probably damaging	Het
Itgax	C	T	7: 128,135,064	A336V	probably damaging	Het
Lin37	A	T	7: 30,556,916	V140E	probably damaging	Het
Malrd1	T	A	2: 15,869,784	I1341K	unknown	Het
Map4k5	T	C	12: 69,818,025	I561V	probably benign	Het
Mcc	A	G	18: 44,724,560	S163P	probably benign	Het
Nlrp12	T	C	7: 3,241,409	T158A	probably damaging	Het
Olfr1440	A	T	19: 12,394,928	I222F	probably damaging	Het
Olfr1475	A	G	19: 13,479,914	C95R	probably damaging	Het
Paqr5	C	T	9: 61,963,783	R171Q	probably damaging	Het
Pax8	A	T	2: 24,441,086	M200K	probably benign	Het
Plcd4	T	C	1: 74,562,070	S498P	probably benign	Het
Poglut1	T	C	16: 38,529,610	Y267C	probably damaging	Het
Pom121l2	T	C	13: 21,983,524	I655T	probably benign	Het
Proca1	G	T	11: 78,194,928	R19L	probably benign	Het
Prr30	A	G	14: 101,198,944	S61P	probably benign	Het
Ranbp17	T	C	11: 33,217,398	S1022G	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rpgrip1	A	G	14: 52,150,012	H1037R	probably damaging	Het
Rpl34	G	T	3: 130,729,277	T6K	probably damaging	Het
Scaper	T	C	9: 55,864,427	T402A	probably benign	Het
Selenow	A	T	7: 15,920,071	V52E	probably damaging	Het
Sept14	T	A	5: 129,697,758	I118L	probably benign	Het
Sis	A	T	3: 72,965,618	N62K	probably benign	Het
Sit1	A	T	4: 43,482,761	C133S	probably benign	Het
Susd3	ACC	AC	13: 49,237,565		probably null	Het
Svep1	A	G	4: 58,064,275	V3236A	probably benign	Het
Taf12	G	A	4: 132,289,414	V168I	possibly damaging	Het
Tas2r139	A	T	6: 42,141,592	R219S	probably damaging	Het
Utp23	T	A	15: 51,877,611	L30Q	probably damaging	Het

Other mutations in Tmc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Tmc1	APN	19	20816192	missense	probably damaging	1.00
IGL02104:Tmc1	APN	19	20832454	missense	probably benign	0.00
IGL02245:Tmc1	APN	19	20799192	missense	probably damaging	1.00
IGL02544:Tmc1	APN	19	20906963	missense	probably benign	0.04
IGL02699:Tmc1	APN	19	20832350	critical splice donor site	probably null
IGL02974:Tmc1	APN	19	20900844	missense	probably benign
IGL03194:Tmc1	APN	19	20804653	missense	probably damaging	1.00
dinner_bell	UTSW	19	20795516	missense	probably damaging	0.99
R0255:Tmc1	UTSW	19	20789587	missense	possibly damaging	0.93
R0381:Tmc1	UTSW	19	20799045	missense	probably damaging	1.00
R0655:Tmc1	UTSW	19	20799176	missense	probably damaging	1.00
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1496:Tmc1	UTSW	19	20868355	missense	probably damaging	1.00
R1542:Tmc1	UTSW	19	20816122	missense	probably damaging	1.00
R1773:Tmc1	UTSW	19	20826501	splice site	probably null
R1777:Tmc1	UTSW	19	20816109	critical splice donor site	probably null
R2067:Tmc1	UTSW	19	20824309	missense	possibly damaging	0.90
R2152:Tmc1	UTSW	19	20856675	missense	probably benign	0.01
R2180:Tmc1	UTSW	19	20824084	missense	probably damaging	0.96
R2204:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2205:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2285:Tmc1	UTSW	19	20789799	missense	probably damaging	0.96
R4505:Tmc1	UTSW	19	20868374	missense	probably benign	0.00
R4752:Tmc1	UTSW	19	20826649	missense	probably benign	0.35
R4975:Tmc1	UTSW	19	20906955	missense	probably damaging	0.96
R5040:Tmc1	UTSW	19	20824030	missense	possibly damaging	0.68
R5206:Tmc1	UTSW	19	20826660	missense	probably damaging	1.00
R5400:Tmc1	UTSW	19	20804602	missense	probably damaging	1.00
R5429:Tmc1	UTSW	19	20789622	missense	possibly damaging	0.72
R6200:Tmc1	UTSW	19	20789590	missense	possibly damaging	0.53
R6784:Tmc1	UTSW	19	20827651	critical splice donor site	probably null
R6808:Tmc1	UTSW	19	20795516	missense	probably damaging	0.99
R6812:Tmc1	UTSW	19	20900861	missense	probably damaging	1.00
R6834:Tmc1	UTSW	19	20795610	nonsense	probably null
R6978:Tmc1	UTSW	19	20804635	missense	probably damaging	1.00
R6986:Tmc1	UTSW	19	20824283	missense	probably benign	0.02
R7027:Tmc1	UTSW	19	20940903	critical splice donor site	probably null
R7378:Tmc1	UTSW	19	20868389	missense	probably damaging	0.98
R7520:Tmc1	UTSW	19	20799178	missense	probably damaging	0.99
R7573:Tmc1	UTSW	19	20907008	missense	probably damaging	0.98
R7825:Tmc1	UTSW	19	20804645	missense	possibly damaging	0.55
R8024:Tmc1	UTSW	19	20900817	missense	probably damaging	1.00
R8073:Tmc1	UTSW	19	20868361	missense	probably benign	0.08
R8786:Tmc1	UTSW	19	20826589	missense	probably damaging	1.00
R8791:Tmc1	UTSW	19	20789845	missense	probably benign	0.00
R8969:Tmc1	UTSW	19	20816229	missense	probably damaging	1.00
R8973:Tmc1	UTSW	19	20900851	missense	probably benign
R9429:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R9493:Tmc1	UTSW	19	20824280	missense	probably benign	0.00
Z1176:Tmc1	UTSW	19	20826506	missense	probably null	1.00
Z1177:Tmc1	UTSW	19	20795608	missense	possibly damaging	0.47
Z1177:Tmc1	UTSW	19	20823982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACATGACTACCAGAGAATCTC -3'
(R):5'- AGCAATGCTCTGATTCCTCCTAG -3'

Sequencing Primer
(F):5'- CATGACTACCAGAGAATCTCATTTC -3'
(R):5'- GGATGGGCTCCTTCTTCGC -3'

Posted On

2018-08-29