Incidental Mutation 'R6796:Tmc1'
ID 533035
Institutional Source Beutler Lab
Gene Symbol Tmc1
Ensembl Gene ENSMUSG00000024749
Gene Name transmembrane channel-like gene family 1
Synonyms 4933416G09Rik, Beethoven, Bth
MMRRC Submission 044909-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.291) question?
Stock # R6796 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 20783458-20954202 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20799036 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 653 (V653D)
Ref Sequence ENSEMBL: ENSMUSP00000040859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039500]
AlphaFold Q8R4P5
Predicted Effect probably damaging
Transcript: ENSMUST00000039500
AA Change: V653D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: V653D

DomainStartEndE-ValueType
SCOP:d1eq1a_ 2 95 3e-3 SMART
low complexity region 129 150 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
Pfam:TMC 512 627 2.6e-36 PFAM
transmembrane domain 632 654 N/A INTRINSIC
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,472,478 V3950A probably damaging Het
App A G 16: 85,120,567 I63T probably damaging Het
Bpifb4 A T 2: 153,961,547 K381N probably damaging Het
Cdc45 C T 16: 18,784,857 A529T probably damaging Het
Cdh18 T A 15: 23,446,073 N536K probably damaging Het
Dpy19l1 C A 9: 24,502,862 R90L possibly damaging Het
E2f3 A G 13: 29,918,585 V231A possibly damaging Het
F930015N05Rik A T 11: 64,435,403 probably benign Het
Fcer2a T C 8: 3,689,830 H47R possibly damaging Het
Hcar2 A G 5: 123,865,267 S58P probably benign Het
Hivep3 A G 4: 120,096,361 T625A possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Itgax C T 7: 128,135,064 A336V probably damaging Het
Lin37 A T 7: 30,556,916 V140E probably damaging Het
Malrd1 T A 2: 15,869,784 I1341K unknown Het
Map4k5 T C 12: 69,818,025 I561V probably benign Het
Mcc A G 18: 44,724,560 S163P probably benign Het
Nlrp12 T C 7: 3,241,409 T158A probably damaging Het
Olfr1440 A T 19: 12,394,928 I222F probably damaging Het
Olfr1475 A G 19: 13,479,914 C95R probably damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pax8 A T 2: 24,441,086 M200K probably benign Het
Plcd4 T C 1: 74,562,070 S498P probably benign Het
Poglut1 T C 16: 38,529,610 Y267C probably damaging Het
Pom121l2 T C 13: 21,983,524 I655T probably benign Het
Proca1 G T 11: 78,194,928 R19L probably benign Het
Prr30 A G 14: 101,198,944 S61P probably benign Het
Ranbp17 T C 11: 33,217,398 S1022G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpgrip1 A G 14: 52,150,012 H1037R probably damaging Het
Rpl34 G T 3: 130,729,277 T6K probably damaging Het
Scaper T C 9: 55,864,427 T402A probably benign Het
Selenow A T 7: 15,920,071 V52E probably damaging Het
Sept14 T A 5: 129,697,758 I118L probably benign Het
Sis A T 3: 72,965,618 N62K probably benign Het
Sit1 A T 4: 43,482,761 C133S probably benign Het
Susd3 ACC AC 13: 49,237,565 probably null Het
Svep1 A G 4: 58,064,275 V3236A probably benign Het
Taf12 G A 4: 132,289,414 V168I possibly damaging Het
Tas2r139 A T 6: 42,141,592 R219S probably damaging Het
Utp23 T A 15: 51,877,611 L30Q probably damaging Het
Other mutations in Tmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Tmc1 APN 19 20816192 missense probably damaging 1.00
IGL02104:Tmc1 APN 19 20832454 missense probably benign 0.00
IGL02245:Tmc1 APN 19 20799192 missense probably damaging 1.00
IGL02544:Tmc1 APN 19 20906963 missense probably benign 0.04
IGL02699:Tmc1 APN 19 20832350 critical splice donor site probably null
IGL02974:Tmc1 APN 19 20900844 missense probably benign
IGL03194:Tmc1 APN 19 20804653 missense probably damaging 1.00
dinner_bell UTSW 19 20795516 missense probably damaging 0.99
R0255:Tmc1 UTSW 19 20789587 missense possibly damaging 0.93
R0381:Tmc1 UTSW 19 20799045 missense probably damaging 1.00
R0655:Tmc1 UTSW 19 20799176 missense probably damaging 1.00
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1496:Tmc1 UTSW 19 20868355 missense probably damaging 1.00
R1542:Tmc1 UTSW 19 20816122 missense probably damaging 1.00
R1773:Tmc1 UTSW 19 20826501 splice site probably null
R1777:Tmc1 UTSW 19 20816109 critical splice donor site probably null
R2067:Tmc1 UTSW 19 20824309 missense possibly damaging 0.90
R2152:Tmc1 UTSW 19 20856675 missense probably benign 0.01
R2180:Tmc1 UTSW 19 20824084 missense probably damaging 0.96
R2204:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2205:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2285:Tmc1 UTSW 19 20789799 missense probably damaging 0.96
R4505:Tmc1 UTSW 19 20868374 missense probably benign 0.00
R4752:Tmc1 UTSW 19 20826649 missense probably benign 0.35
R4975:Tmc1 UTSW 19 20906955 missense probably damaging 0.96
R5040:Tmc1 UTSW 19 20824030 missense possibly damaging 0.68
R5206:Tmc1 UTSW 19 20826660 missense probably damaging 1.00
R5400:Tmc1 UTSW 19 20804602 missense probably damaging 1.00
R5429:Tmc1 UTSW 19 20789622 missense possibly damaging 0.72
R6200:Tmc1 UTSW 19 20789590 missense possibly damaging 0.53
R6784:Tmc1 UTSW 19 20827651 critical splice donor site probably null
R6808:Tmc1 UTSW 19 20795516 missense probably damaging 0.99
R6812:Tmc1 UTSW 19 20900861 missense probably damaging 1.00
R6834:Tmc1 UTSW 19 20795610 nonsense probably null
R6978:Tmc1 UTSW 19 20804635 missense probably damaging 1.00
R6986:Tmc1 UTSW 19 20824283 missense probably benign 0.02
R7027:Tmc1 UTSW 19 20940903 critical splice donor site probably null
R7378:Tmc1 UTSW 19 20868389 missense probably damaging 0.98
R7520:Tmc1 UTSW 19 20799178 missense probably damaging 0.99
R7573:Tmc1 UTSW 19 20907008 missense probably damaging 0.98
R7825:Tmc1 UTSW 19 20804645 missense possibly damaging 0.55
R8024:Tmc1 UTSW 19 20900817 missense probably damaging 1.00
R8073:Tmc1 UTSW 19 20868361 missense probably benign 0.08
R8786:Tmc1 UTSW 19 20826589 missense probably damaging 1.00
R8791:Tmc1 UTSW 19 20789845 missense probably benign 0.00
R8969:Tmc1 UTSW 19 20816229 missense probably damaging 1.00
R8973:Tmc1 UTSW 19 20900851 missense probably benign
R9429:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R9493:Tmc1 UTSW 19 20824280 missense probably benign 0.00
Z1176:Tmc1 UTSW 19 20826506 missense probably null 1.00
Z1177:Tmc1 UTSW 19 20795608 missense possibly damaging 0.47
Z1177:Tmc1 UTSW 19 20823982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATGACTACCAGAGAATCTC -3'
(R):5'- AGCAATGCTCTGATTCCTCCTAG -3'

Sequencing Primer
(F):5'- CATGACTACCAGAGAATCTCATTTC -3'
(R):5'- GGATGGGCTCCTTCTTCGC -3'
Posted On 2018-08-29