Incidental Mutation 'R6797:Angptl2'
ID533038
Institutional Source Beutler Lab
Gene Symbol Angptl2
Ensembl Gene ENSMUSG00000004105
Gene Nameangiopoietin-like 2
SynonymsArp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location33216069-33247717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33228265 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 17 (V17A)
Ref Sequence ENSEMBL: ENSMUSP00000142084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004208] [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298] [ENSMUST00000193373]
Predicted Effect probably benign
Transcript: ENSMUST00000004208
AA Change: V17A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004208
Gene: ENSMUSG00000004105
AA Change: V17A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 77 113 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 205 228 N/A INTRINSIC
FBG 273 488 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042615
SMART Domains Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 273 4.59e-86 SMART
low complexity region 286 301 N/A INTRINSIC
PH 372 485 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091039
SMART Domains Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 460 573 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113165
SMART Domains Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 459 572 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131298
SMART Domains Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
PH 390 503 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193373
AA Change: V17A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142084
Gene: ENSMUSG00000004105
AA Change: V17A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fibrinogen_C 49 112 4.2e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. ANGPTL2 protein is a secreted glycoprotein with homology to the angiopoietins and may exert a function on endothelial cells through autocrine or paracrine action. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high-fat diet, mice homozygous for a knock-out allele show decreased weight gain, reduced adipocity, a lower respiratory quotient, reduced inflammation in adipose tissues, enhanced glucose tolerance, and increased insulin sensitivity in both skeletal muscle and liver relative to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Angptl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Angptl2 APN 2 33228394 missense probably damaging 1.00
IGL00585:Angptl2 APN 2 33246227 missense probably damaging 0.98
IGL00900:Angptl2 APN 2 33243772 missense probably benign 0.00
IGL01521:Angptl2 APN 2 33246203 missense probably damaging 1.00
IGL02711:Angptl2 APN 2 33228243 missense probably benign 0.00
IGL02826:Angptl2 APN 2 33228315 missense probably benign 0.19
R1309:Angptl2 UTSW 2 33246128 missense probably benign 0.38
R1541:Angptl2 UTSW 2 33246165 missense probably benign 0.26
R1542:Angptl2 UTSW 2 33228885 missense probably benign 0.24
R1604:Angptl2 UTSW 2 33243773 missense possibly damaging 0.89
R3432:Angptl2 UTSW 2 33228802 missense probably benign 0.02
R4331:Angptl2 UTSW 2 33228748 missense probably damaging 0.99
R4652:Angptl2 UTSW 2 33243883 missense probably damaging 1.00
R4741:Angptl2 UTSW 2 33246188 missense probably benign 0.12
R5107:Angptl2 UTSW 2 33228603 missense probably damaging 0.98
R5504:Angptl2 UTSW 2 33229038 intron probably benign
R5694:Angptl2 UTSW 2 33228616 missense probably damaging 1.00
R5967:Angptl2 UTSW 2 33228706 missense probably damaging 1.00
R6185:Angptl2 UTSW 2 33229014 missense probably benign 0.00
R7151:Angptl2 UTSW 2 33243910 nonsense probably null
R7471:Angptl2 UTSW 2 33243739 missense possibly damaging 0.89
R7742:Angptl2 UTSW 2 33243916 missense probably damaging 1.00
R7763:Angptl2 UTSW 2 33242382 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTGTATTTGGGGAACGTCCTAC -3'
(R):5'- ATTGTTGAGCAGCTCCAGC -3'

Sequencing Primer
(F):5'- TTGGGGAACGTCCTACCTTGC -3'
(R):5'- CTCAGGCTCCTTGGAGTTGACAC -3'
Posted On2018-08-29