Incidental Mutation 'R6797:Tlk1'
ID533039
Institutional Source Beutler Lab
Gene Symbol Tlk1
Ensembl Gene ENSMUSG00000041997
Gene Nametousled-like kinase 1
Synonyms4930545J15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location70712407-70825728 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 70738426 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 411 (K411*)
Ref Sequence ENSEMBL: ENSMUSP00000035961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038584]
Predicted Effect probably null
Transcript: ENSMUST00000038584
AA Change: K411*
SMART Domains Protein: ENSMUSP00000035961
Gene: ENSMUSG00000041997
AA Change: K411*

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
low complexity region 68 85 N/A INTRINSIC
low complexity region 170 192 N/A INTRINSIC
coiled coil region 248 277 N/A INTRINSIC
coiled coil region 403 441 N/A INTRINSIC
S_TKc 456 734 4.41e-75 SMART
Meta Mutation Damage Score 0.626 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Tlk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Tlk1 APN 2 70745516 missense probably damaging 1.00
IGL01087:Tlk1 APN 2 70752316 missense possibly damaging 0.64
IGL01514:Tlk1 APN 2 70752266 missense probably benign 0.00
IGL02976:Tlk1 APN 2 70721591 nonsense probably null
IGL03024:Tlk1 APN 2 70746036 nonsense probably null
aku-aku UTSW 2 70738445 missense probably damaging 0.98
Heyerdahl UTSW 2 70738426 nonsense probably null
K3955:Tlk1 UTSW 2 70721701 missense possibly damaging 0.85
R0107:Tlk1 UTSW 2 70713989 makesense probably null
R0226:Tlk1 UTSW 2 70714169 unclassified probably benign
R0332:Tlk1 UTSW 2 70745565 synonymous probably null
R0601:Tlk1 UTSW 2 70714158 missense probably benign 0.44
R1739:Tlk1 UTSW 2 70721077 missense probably damaging 1.00
R2080:Tlk1 UTSW 2 70738445 missense probably damaging 0.98
R2422:Tlk1 UTSW 2 70770005 missense probably damaging 1.00
R3843:Tlk1 UTSW 2 70749327 missense probably benign 0.05
R3970:Tlk1 UTSW 2 70716652 missense probably damaging 1.00
R4191:Tlk1 UTSW 2 70725547 missense probably damaging 1.00
R4867:Tlk1 UTSW 2 70721571 nonsense probably null
R5022:Tlk1 UTSW 2 70742065 missense probably benign 0.10
R5275:Tlk1 UTSW 2 70752205 intron probably benign
R5469:Tlk1 UTSW 2 70721668 missense probably benign 0.15
R6531:Tlk1 UTSW 2 70742083 missense probably benign 0.00
R6592:Tlk1 UTSW 2 70714153 missense probably damaging 1.00
R7030:Tlk1 UTSW 2 70721928 missense probably damaging 1.00
X0028:Tlk1 UTSW 2 70746031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAACTGGACCAACTATCTAGAG -3'
(R):5'- TGGTAAAATTGTGCTGAAGAGGATC -3'

Sequencing Primer
(F):5'- GCTTATAAAAATTTCCTGGGTATGC -3'
(R):5'- AGGATCATAAAGGGGTTTTTCGACC -3'
Posted On2018-08-29