Incidental Mutation 'R6797:Pak7'
ID533040
Institutional Source Beutler Lab
Gene Symbol Pak7
Ensembl Gene ENSMUSG00000039913
Gene Namep21 (RAC1) activated kinase 7
Synonyms2900083L08Rik, Pak5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location136081104-136387967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136097534 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 560 (H560Q)
Ref Sequence ENSEMBL: ENSMUSP00000076440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035264] [ENSMUST00000077200]
Predicted Effect probably damaging
Transcript: ENSMUST00000035264
AA Change: H560Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047285
Gene: ENSMUSG00000039913
AA Change: H560Q

DomainStartEndE-ValueType
PBD 11 46 5.3e-13 SMART
low complexity region 394 415 N/A INTRINSIC
S_TKc 449 700 1.39e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077200
AA Change: H560Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076440
Gene: ENSMUSG00000039913
AA Change: H560Q

DomainStartEndE-ValueType
PBD 11 46 5.3e-13 SMART
low complexity region 394 415 N/A INTRINSIC
S_TKc 449 700 1.39e-90 SMART
Meta Mutation Damage Score 0.8819 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PAK family of Ser/Thr protein kinases. PAK family members are known to be effectors of Rac/Cdc42 GTPases, which have been implicated in the regulation of cytoskeletal dynamics, proliferation, and cell survival signaling. This kinase contains a CDC42/Rac1 interactive binding (CRIB) motif, and has been shown to bind CDC42 in the presence of GTP. This kinase is predominantly expressed in brain. It is capable of promoting neurite outgrowth, and thus may play a role in neurite development. This kinase is associated with microtubule networks and induces microtubule stabilization. The subcellular localization of this kinase is tightly regulated during cell cycle progression. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit impaired active avoidance learning but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Pak7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Pak7 APN 2 136116373 missense possibly damaging 0.89
IGL01743:Pak7 APN 2 136087413 missense probably damaging 1.00
IGL02601:Pak7 APN 2 136116935 nonsense probably null
IGL03172:Pak7 APN 2 136098390 nonsense probably null
currency UTSW 2 136100939 missense probably benign 0.15
Depreciation UTSW 2 136097534 missense probably damaging 1.00
PIT4498001:Pak7 UTSW 2 136083291 missense probably damaging 1.00
R0025:Pak7 UTSW 2 136100784 missense possibly damaging 0.68
R0025:Pak7 UTSW 2 136100784 missense possibly damaging 0.68
R0400:Pak7 UTSW 2 136097579 missense possibly damaging 0.95
R0441:Pak7 UTSW 2 136116629 missense probably benign
R1653:Pak7 UTSW 2 136116887 missense probably damaging 1.00
R1662:Pak7 UTSW 2 136116760 missense probably damaging 0.96
R1855:Pak7 UTSW 2 136087509 missense probably benign 0.00
R1872:Pak7 UTSW 2 136085588 missense possibly damaging 0.93
R2001:Pak7 UTSW 2 136116637 missense probably benign 0.00
R2002:Pak7 UTSW 2 136116637 missense probably benign 0.00
R2157:Pak7 UTSW 2 136100957 missense probably damaging 0.96
R2160:Pak7 UTSW 2 136098382 missense probably benign 0.01
R2217:Pak7 UTSW 2 136116203 missense probably damaging 1.00
R3797:Pak7 UTSW 2 136100826 missense probably benign 0.06
R4711:Pak7 UTSW 2 136087517 missense probably damaging 1.00
R4904:Pak7 UTSW 2 136083347 missense probably benign 0.02
R5090:Pak7 UTSW 2 136087418 missense probably damaging 1.00
R5120:Pak7 UTSW 2 136083229 missense probably damaging 0.97
R5669:Pak7 UTSW 2 136116284 missense probably damaging 1.00
R5954:Pak7 UTSW 2 136116463 missense probably benign 0.01
R6127:Pak7 UTSW 2 136087406 missense probably damaging 0.99
R6250:Pak7 UTSW 2 136174269 start gained probably benign
R6471:Pak7 UTSW 2 136116190 missense probably benign 0.00
R6809:Pak7 UTSW 2 136097581 missense possibly damaging 0.83
R6945:Pak7 UTSW 2 136100939 missense probably benign 0.15
R7254:Pak7 UTSW 2 136116764 missense possibly damaging 0.50
R7265:Pak7 UTSW 2 136101185 missense probably benign 0.03
R7335:Pak7 UTSW 2 136098299 missense probably damaging 1.00
R7511:Pak7 UTSW 2 136083324 missense possibly damaging 0.87
R7573:Pak7 UTSW 2 136116305 missense probably damaging 1.00
R7593:Pak7 UTSW 2 136100964 missense probably benign 0.40
R7908:Pak7 UTSW 2 136116559 missense probably benign 0.14
R8304:Pak7 UTSW 2 136098283 missense probably benign 0.11
Z1176:Pak7 UTSW 2 136083246 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGGCGATGTGTGACTAAC -3'
(R):5'- TGTGATAATCATGTCCCAGGG -3'

Sequencing Primer
(F):5'- GCGATGTGTGACTAACAAAAATTAG -3'
(R):5'- TTTCTAGGTGAGGCTAGAGACATAC -3'
Posted On2018-08-29