Incidental Mutation 'R6797:Cd93'
ID533041
Institutional Source Beutler Lab
Gene Symbol Cd93
Ensembl Gene ENSMUSG00000027435
Gene NameCD93 antigen
SynonymsC1qrp, AA4.1, Ly68, 6030404G09Rik, C1qr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location148436640-148443563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148442124 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 434 (N434S)
Ref Sequence ENSEMBL: ENSMUSP00000096876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099269]
Predicted Effect probably benign
Transcript: ENSMUST00000099269
AA Change: N434S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096876
Gene: ENSMUSG00000027435
AA Change: N434S

DomainStartEndE-ValueType
CLECT 23 180 5.04e-7 SMART
EGF 260 298 2.56e-3 SMART
EGF 302 341 3.73e-5 SMART
EGF_CA 342 381 1.33e-10 SMART
EGF_CA 382 423 4.38e-11 SMART
EGF_CA 424 465 1.33e-10 SMART
low complexity region 488 501 N/A INTRINSIC
transmembrane domain 576 598 N/A INTRINSIC
low complexity region 604 612 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein and type I membrane protein that was originally identified as a myeloid cell-specific marker. The encoded protein was once thought to be a receptor for C1q, but now is thought to instead be involved in intercellular adhesion and in the clearance of apoptotic cells. The intracellular cytoplasmic tail of this protein has been found to interact with moesin, a protein known to play a role in linking transmembrane proteins to the cytoskeleton and in the remodelling of the cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have a defect in clearance of apoptotic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Cd93
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0076:Cd93 UTSW 2 148442136 missense probably benign
R0379:Cd93 UTSW 2 148441510 splice site probably benign
R1951:Cd93 UTSW 2 148441858 missense probably benign 0.01
R2399:Cd93 UTSW 2 148442151 missense probably benign 0.37
R4231:Cd93 UTSW 2 148442960 missense probably benign 0.02
R4830:Cd93 UTSW 2 148443379 nonsense probably null
R5940:Cd93 UTSW 2 148442232 missense probably benign 0.25
R6057:Cd93 UTSW 2 148441519 missense probably damaging 1.00
R7142:Cd93 UTSW 2 148441805 nonsense probably null
R7184:Cd93 UTSW 2 148442539 missense possibly damaging 0.76
R7276:Cd93 UTSW 2 148441740 missense probably damaging 0.98
R7315:Cd93 UTSW 2 148442541 missense probably damaging 1.00
Z1088:Cd93 UTSW 2 148442364 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACTGGGCATTTCAGTAGGAGG -3'
(R):5'- GCTTCCACTGTGAATGTTGG -3'

Sequencing Primer
(F):5'- TCAGTAGGAGGCATAGTACTCTCC -3'
(R):5'- GGTTACCAACCCAGTGGC -3'
Posted On2018-08-29