Mutagenetix > Incidental Mutation

Incidental Mutation 'R6797:Cenpe'

533042

Institutional Source

Beutler Lab

Gene Symbol

Cenpe

Ensembl Gene

ENSMUSG00000045328

Gene Name

centromere protein E

Synonyms

312kDa, CENP-E, Kif10, N-7 kinesin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6797 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135212537-135273611 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 135238138 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 938 (Q938L)

Ref Sequence

ENSEMBL: ENSMUSP00000057938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062893
AA Change: Q938L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: Q938L

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197369

SMART Domains

Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

Domain	Start	End	E-Value	Type
coiled coil region	2	49	N/A	INTRINSIC
coiled coil region	85	172	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 96.8%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c18	T	A	13: 4,145,277	I61L	probably benign	Het
Angptl2	T	C	2: 33,228,265	V17A	probably benign	Het
Casp14	T	C	10: 78,715,141	D70G	possibly damaging	Het
Cckbr	A	G	7: 105,434,566	M234V	possibly damaging	Het
Cd93	T	C	2: 148,442,124	N434S	probably benign	Het
Col6a3	A	C	1: 90,804,088	V1481G	probably damaging	Het
Dnah5	G	T	15: 28,233,238	E248*	probably null	Het
Dnah5	G	A	15: 28,451,463	R4349Q	probably damaging	Het
F11	A	G	8: 45,253,055	Y98H	probably benign	Het
Fam208b	T	C	13: 3,576,769	I1060M	probably benign	Het
Fen1	A	G	19: 10,200,703	F126L	probably benign	Het
Gpr146	G	A	5: 139,393,040	G199D	possibly damaging	Het
Gramd1b	A	G	9: 40,308,406	I324T	probably benign	Het
Hist1h2bk	A	T	13: 22,036,089	N68I	probably benign	Het
Hivep1	C	A	13: 42,157,081	S932R	probably benign	Het
Hk3	A	T	13: 55,010,831		probably null	Het
Hspbp1	T	A	7: 4,660,782	M355L	possibly damaging	Het
Jaml	T	C	9: 45,088,760	C77R	probably damaging	Het
Kmt2e	A	G	5: 23,482,507	N452D	possibly damaging	Het
Krt5	T	C	15: 101,712,641	Y57C	unknown	Het
Lipn	A	T	19: 34,080,760	M294L	probably benign	Het
Magel2	A	G	7: 62,380,159	E937G	unknown	Het
Med13l	G	A	5: 118,759,264		probably null	Het
Mrgprb8	G	A	7: 48,389,144	V188I	probably benign	Het
Ocln	T	C	13: 100,539,715	D90G	probably damaging	Het
Ofcc1	C	T	13: 40,087,947	R695Q	possibly damaging	Het
Olfr598	G	A	7: 103,329,121	V212I	probably benign	Het
Olfr748	T	A	14: 50,711,106	Y259N	probably damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Pak7	A	T	2: 136,097,534	H560Q	probably damaging	Het
Pigg	T	C	5: 108,332,828	S493P	probably damaging	Het
Ppp6r3	A	G	19: 3,514,719	W185R	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Sacs	T	A	14: 61,213,073	D4189E	probably damaging	Het
Serpinb9b	A	G	13: 33,029,484	N8S	possibly damaging	Het
Slit3	A	G	11: 35,633,952	T730A	possibly damaging	Het
Srgap3	A	T	6: 112,829,542	F53I	probably damaging	Het
Stc2	T	A	11: 31,365,351	K163*	probably null	Het
Tlk1	T	A	2: 70,738,426	K411*	probably null	Het
Ttc27	G	T	17: 74,729,888	L185F	probably benign	Het
Vmn2r102	C	T	17: 19,660,432	Q12*	probably null	Het
Vmn2r95	C	T	17: 18,452,289		probably benign	Het
Vopp1	A	G	6: 57,762,507	Y19H	possibly damaging	Het
Wdr64	T	A	1: 175,810,610		probably null	Het

Other mutations in Cenpe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Cenpe	APN	3	135231455	critical splice donor site	probably null
IGL00799:Cenpe	APN	3	135228917	critical splice donor site	probably null
IGL00815:Cenpe	APN	3	135259351	missense	probably benign
IGL01446:Cenpe	APN	3	135237539	missense	probably benign	0.01
IGL01469:Cenpe	APN	3	135228806	missense	probably damaging	1.00
IGL01843:Cenpe	APN	3	135218507	missense	possibly damaging	0.88
IGL02254:Cenpe	APN	3	135255477	missense	probably benign
IGL02337:Cenpe	APN	3	135220276	splice site	probably benign
IGL02382:Cenpe	APN	3	135247386	missense	probably benign
IGL02458:Cenpe	APN	3	135230108	nonsense	probably null
IGL02934:Cenpe	APN	3	135264351	missense	probably damaging	1.00
IGL03335:Cenpe	APN	3	135243625	missense	probably benign
R0086:Cenpe	UTSW	3	135264424	splice site	probably benign
R0173:Cenpe	UTSW	3	135259983	missense	probably benign	0.00
R0394:Cenpe	UTSW	3	135216425	splice site	probably benign
R0411:Cenpe	UTSW	3	135222255	missense	probably damaging	1.00
R0624:Cenpe	UTSW	3	135246586	missense	probably benign	0.00
R0634:Cenpe	UTSW	3	135246827	missense	probably damaging	1.00
R0648:Cenpe	UTSW	3	135230082	missense	probably damaging	1.00
R0691:Cenpe	UTSW	3	135217305	missense	probably damaging	1.00
R1184:Cenpe	UTSW	3	135264422	critical splice donor site	probably null
R1530:Cenpe	UTSW	3	135246902	missense	possibly damaging	0.92
R1559:Cenpe	UTSW	3	135270900	missense	probably benign	0.07
R1562:Cenpe	UTSW	3	135238394	missense	possibly damaging	0.53
R1568:Cenpe	UTSW	3	135239758	missense	probably benign	0.01
R1712:Cenpe	UTSW	3	135265933	missense	probably damaging	0.99
R1828:Cenpe	UTSW	3	135246496	missense	probably damaging	0.99
R1846:Cenpe	UTSW	3	135239845	missense	probably damaging	1.00
R1861:Cenpe	UTSW	3	135268979	missense	probably damaging	1.00
R1938:Cenpe	UTSW	3	135247479	missense	probably damaging	0.98
R1961:Cenpe	UTSW	3	135242493	missense	probably damaging	1.00
R2062:Cenpe	UTSW	3	135222321	splice site	probably benign
R2118:Cenpe	UTSW	3	135246884	missense	possibly damaging	0.94
R2127:Cenpe	UTSW	3	135239780	missense	probably benign	0.08
R2156:Cenpe	UTSW	3	135247474	missense	probably benign	0.34
R2265:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2268:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2392:Cenpe	UTSW	3	135248113	missense	probably damaging	1.00
R2508:Cenpe	UTSW	3	135241073	missense	possibly damaging	0.92
R3084:Cenpe	UTSW	3	135241021	missense	probably damaging	1.00
R3779:Cenpe	UTSW	3	135256576	missense	possibly damaging	0.87
R3833:Cenpe	UTSW	3	135222322	splice site	probably benign
R3974:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135238472	critical splice donor site	probably null
R4151:Cenpe	UTSW	3	135215153	missense	probably benign	0.36
R4166:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R4581:Cenpe	UTSW	3	135247000	missense	probably benign	0.30
R4622:Cenpe	UTSW	3	135243708	missense	probably benign	0.22
R4692:Cenpe	UTSW	3	135216379	missense	probably benign	0.29
R4769:Cenpe	UTSW	3	135248151	missense	probably benign
R4976:Cenpe	UTSW	3	135234876	missense	probably damaging	1.00
R4983:Cenpe	UTSW	3	135234928	missense	probably damaging	1.00
R4990:Cenpe	UTSW	3	135256640	missense	probably damaging	1.00
R5002:Cenpe	UTSW	3	135247081	missense	probably benign
R5057:Cenpe	UTSW	3	135220313	missense	probably benign	0.14
R5063:Cenpe	UTSW	3	135270954	missense	probably damaging	0.99
R5181:Cenpe	UTSW	3	135242303	missense	probably damaging	0.99
R5281:Cenpe	UTSW	3	135230150	missense	possibly damaging	0.89
R5389:Cenpe	UTSW	3	135259388	critical splice donor site	probably null
R5517:Cenpe	UTSW	3	135223265	missense	probably damaging	1.00
R5521:Cenpe	UTSW	3	135269065	missense	probably damaging	1.00
R5607:Cenpe	UTSW	3	135235076	nonsense	probably null
R5608:Cenpe	UTSW	3	135235076	nonsense	probably null
R5627:Cenpe	UTSW	3	135235473	missense	possibly damaging	0.51
R5766:Cenpe	UTSW	3	135248413	missense	probably damaging	0.96
R5783:Cenpe	UTSW	3	135261580	missense	probably benign	0.00
R5933:Cenpe	UTSW	3	135261628	missense	probably benign	0.03
R6073:Cenpe	UTSW	3	135260073	nonsense	probably null
R6163:Cenpe	UTSW	3	135269003	missense	probably damaging	0.99
R6192:Cenpe	UTSW	3	135248530	missense	possibly damaging	0.93
R6224:Cenpe	UTSW	3	135243775	missense	possibly damaging	0.87
R6313:Cenpe	UTSW	3	135230175	missense	probably benign	0.26
R6326:Cenpe	UTSW	3	135239778	missense	probably benign	0.15
R6383:Cenpe	UTSW	3	135251528	missense	probably damaging	1.00
R6418:Cenpe	UTSW	3	135251544	missense	probably damaging	0.99
R6810:Cenpe	UTSW	3	135243822	missense	probably benign	0.00
R6989:Cenpe	UTSW	3	135235127	missense	probably damaging	1.00
R7009:Cenpe	UTSW	3	135235201	missense	probably damaging	0.97
R7009:Cenpe	UTSW	3	135235202	missense	probably benign	0.02
R7039:Cenpe	UTSW	3	135255456	missense	probably benign	0.28
R7387:Cenpe	UTSW	3	135247037	missense	probably benign	0.05
R7470:Cenpe	UTSW	3	135242155	missense	probably damaging	1.00
R7535:Cenpe	UTSW	3	135243762	missense	possibly damaging	0.90
R7562:Cenpe	UTSW	3	135248634	missense	probably damaging	1.00
R7573:Cenpe	UTSW	3	135247459	missense	probably damaging	1.00
R7613:Cenpe	UTSW	3	135242302	missense	possibly damaging	0.90
R7741:Cenpe	UTSW	3	135247335	splice site	probably null
R7771:Cenpe	UTSW	3	135240941	splice site	probably null
R7843:Cenpe	UTSW	3	135232959	nonsense	probably null
R7973:Cenpe	UTSW	3	135223250	missense	probably damaging	1.00
R8036:Cenpe	UTSW	3	135239848	frame shift	probably null
R8069:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R8151:Cenpe	UTSW	3	135247022	missense	probably benign	0.28
R8176:Cenpe	UTSW	3	135230090	missense	probably damaging	1.00
R8191:Cenpe	UTSW	3	135251614	missense	probably benign
R8251:Cenpe	UTSW	3	135251684	critical splice donor site	probably null
R8425:Cenpe	UTSW	3	135242627	nonsense	probably null
R8488:Cenpe	UTSW	3	135259241	missense	probably damaging	1.00
R8811:Cenpe	UTSW	3	135223240	missense	probably damaging	1.00
R8850:Cenpe	UTSW	3	135225016	missense	probably damaging	1.00
R8879:Cenpe	UTSW	3	135260101	missense	probably damaging	0.99
R8899:Cenpe	UTSW	3	135239883	missense	probably benign	0.18
R9035:Cenpe	UTSW	3	135270811	missense	probably benign	0.01
R9038:Cenpe	UTSW	3	135218036	missense	probably benign	0.00
R9093:Cenpe	UTSW	3	135239880	nonsense	probably null
R9221:Cenpe	UTSW	3	135230078	missense	possibly damaging	0.90
R9365:Cenpe	UTSW	3	135248446	missense	possibly damaging	0.56
R9443:Cenpe	UTSW	3	135270848	missense	probably damaging	0.99
Z1177:Cenpe	UTSW	3	135216385	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GCTTTCTCACAAGACTCAAGAGC -3'
(R):5'- TTGTTTCAGAGACTCCAGAGC -3'

Sequencing Primer
(F):5'- CTTGAGCAGAAAACAGTTGAGGGTC -3'
(R):5'- GACTCCAGAGCATTTAGTAACTGCTC -3'

Posted On

2018-08-29