Incidental Mutation 'R6797:Gpr146'
ID533046
Institutional Source Beutler Lab
Gene Symbol Gpr146
Ensembl Gene ENSMUSG00000044197
Gene NameG protein-coupled receptor 146
SynonymsPGR8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location139377697-139396415 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139393040 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 199 (G199D)
Ref Sequence ENSEMBL: ENSMUSP00000098083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051293] [ENSMUST00000066052] [ENSMUST00000100514] [ENSMUST00000138631] [ENSMUST00000198474]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051293
AA Change: G199D

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049707
Gene: ENSMUSG00000044197
AA Change: G199D

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:7tm_1 43 294 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066052
SMART Domains Protein: ENSMUSP00000069230
Gene: ENSMUSG00000053553

DomainStartEndE-ValueType
low complexity region 54 77 N/A INTRINSIC
Pfam:DUF2373 103 165 3e-26 PFAM
low complexity region 184 194 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100514
AA Change: G199D

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098083
Gene: ENSMUSG00000044197
AA Change: G199D

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:7tm_1 43 294 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138631
SMART Domains Protein: ENSMUSP00000119464
Gene: ENSMUSG00000044197

DomainStartEndE-ValueType
SCOP:d1l9ha_ 26 80 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198474
SMART Domains Protein: ENSMUSP00000142949
Gene: ENSMUSG00000053553

DomainStartEndE-ValueType
low complexity region 54 77 N/A INTRINSIC
Pfam:DUF2373 102 141 9e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Gpr146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Gpr146 APN 5 139378904 intron probably benign
IGL02152:Gpr146 APN 5 139392712 missense probably damaging 1.00
IGL02369:Gpr146 APN 5 139392688 missense probably benign 0.00
IGL02392:Gpr146 APN 5 139392778 missense probably damaging 0.99
IGL02828:Gpr146 APN 5 139392821 missense probably damaging 0.97
IGL03095:Gpr146 APN 5 139392950 missense probably benign 0.11
R0360:Gpr146 UTSW 5 139379178 intron probably benign
R0364:Gpr146 UTSW 5 139379178 intron probably benign
R0746:Gpr146 UTSW 5 139393222 missense probably damaging 1.00
R1446:Gpr146 UTSW 5 139393422 missense probably benign 0.00
R1507:Gpr146 UTSW 5 139393369 missense probably benign
R1758:Gpr146 UTSW 5 139393382 missense probably benign 0.34
R2032:Gpr146 UTSW 5 139379147 intron probably benign
R6513:Gpr146 UTSW 5 139392818 missense probably damaging 1.00
R7830:Gpr146 UTSW 5 139392602 missense probably benign 0.02
R7977:Gpr146 UTSW 5 139392685 missense possibly damaging 0.53
R7987:Gpr146 UTSW 5 139392685 missense possibly damaging 0.53
R8225:Gpr146 UTSW 5 139392616 missense probably benign 0.03
X0064:Gpr146 UTSW 5 139378909 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACATGGCCAGTGTGTACAAC -3'
(R):5'- CTGTAGGATGCCCAGATAATGCC -3'

Sequencing Primer
(F):5'- GTGTACAACACCCGGCACG -3'
(R):5'- CGTGACGTCAGCACTGTGTG -3'
Posted On2018-08-29