Incidental Mutation 'R6797:Srgap3'
ID533048
Institutional Source Beutler Lab
Gene Symbol Srgap3
Ensembl Gene ENSMUSG00000030257
Gene NameSLIT-ROBO Rho GTPase activating protein 3
SynonymsD130026O08Rik, Arhgap14
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location112717971-112947266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112829542 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 53 (F53I)
Ref Sequence ENSEMBL: ENSMUSP00000108794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088373] [ENSMUST00000113169]
Predicted Effect probably damaging
Transcript: ENSMUST00000088373
AA Change: F53I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085712
Gene: ENSMUSG00000030257
AA Change: F53I

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
RhoGAP 517 691 7.43e-66 SMART
SH3 747 802 9.69e-15 SMART
coiled coil region 955 985 N/A INTRINSIC
low complexity region 1025 1038 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113169
AA Change: F53I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108794
Gene: ENSMUSG00000030257
AA Change: F53I

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
Blast:RhoGAP 434 474 4e-11 BLAST
low complexity region 476 488 N/A INTRINSIC
RhoGAP 493 667 7.43e-66 SMART
SH3 723 778 9.69e-15 SMART
coiled coil region 931 961 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in spine density in the brain CA1 and cortical layers IV/V. Mice homozygous for a different knock-out allele exhibit a neurodevelopment disorder with schizophrenia-related intermediate phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Srgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Srgap3 APN 6 112739397 missense probably damaging 0.98
IGL01325:Srgap3 APN 6 112775686 missense probably damaging 1.00
IGL01608:Srgap3 APN 6 112946478 missense probably benign 0.00
IGL01626:Srgap3 APN 6 112773648 missense probably damaging 0.98
IGL01787:Srgap3 APN 6 112723022 missense probably benign 0.00
IGL02698:Srgap3 APN 6 112746928 missense probably damaging 0.98
IGL02805:Srgap3 APN 6 112727263 missense probably damaging 0.99
IGL02813:Srgap3 APN 6 112731480 missense probably damaging 1.00
IGL02876:Srgap3 APN 6 112771453 missense probably damaging 1.00
IGL03264:Srgap3 APN 6 112816675 missense probably damaging 1.00
IGL03342:Srgap3 APN 6 112775687 missense probably damaging 1.00
R0007:Srgap3 UTSW 6 112829512 missense probably damaging 1.00
R0371:Srgap3 UTSW 6 112771471 missense probably damaging 0.99
R0607:Srgap3 UTSW 6 112723119 missense probably damaging 1.00
R1628:Srgap3 UTSW 6 112739370 missense probably damaging 0.99
R1669:Srgap3 UTSW 6 112722904 missense probably benign 0.36
R1858:Srgap3 UTSW 6 112771518 missense probably damaging 1.00
R1876:Srgap3 UTSW 6 112775566 missense probably damaging 0.98
R1896:Srgap3 UTSW 6 112738997 missense probably benign 0.11
R2159:Srgap3 UTSW 6 112771378 missense probably damaging 0.99
R2221:Srgap3 UTSW 6 112946493 missense probably damaging 0.98
R2862:Srgap3 UTSW 6 112722972 missense probably damaging 0.99
R3160:Srgap3 UTSW 6 112729658 missense probably benign 0.00
R3162:Srgap3 UTSW 6 112729658 missense probably benign 0.00
R4092:Srgap3 UTSW 6 112723084 missense probably benign 0.00
R4561:Srgap3 UTSW 6 112781054 missense probably damaging 0.98
R4781:Srgap3 UTSW 6 112757425 intron probably benign
R4825:Srgap3 UTSW 6 112727310 missense probably benign
R4887:Srgap3 UTSW 6 112746934 missense probably damaging 1.00
R5304:Srgap3 UTSW 6 112766939 missense probably damaging 1.00
R5556:Srgap3 UTSW 6 112739078 missense probably damaging 0.99
R5672:Srgap3 UTSW 6 112775561 missense probably benign
R5879:Srgap3 UTSW 6 112722846 missense possibly damaging 0.67
R5944:Srgap3 UTSW 6 112795814 missense possibly damaging 0.89
R6277:Srgap3 UTSW 6 112739383 missense probably benign 0.02
R6298:Srgap3 UTSW 6 112816610 missense probably damaging 0.98
R6407:Srgap3 UTSW 6 112723006 missense probably damaging 0.99
R6408:Srgap3 UTSW 6 112723006 missense probably damaging 0.99
R6852:Srgap3 UTSW 6 112816661 missense probably damaging 1.00
R6965:Srgap3 UTSW 6 112723129 missense probably damaging 1.00
R7055:Srgap3 UTSW 6 112746963 missense probably damaging 0.97
R7067:Srgap3 UTSW 6 112757305 intron probably benign
R7361:Srgap3 UTSW 6 112746921 missense probably damaging 0.99
R7479:Srgap3 UTSW 6 112735833 critical splice donor site probably null
R7606:Srgap3 UTSW 6 112739376 missense probably benign 0.00
R7731:Srgap3 UTSW 6 112766897 missense probably benign 0.36
R7787:Srgap3 UTSW 6 112775559 missense probably benign 0.02
R7990:Srgap3 UTSW 6 112739427 splice site probably null
R8026:Srgap3 UTSW 6 112739364 missense probably benign 0.00
R8040:Srgap3 UTSW 6 112739364 missense probably benign 0.00
R8066:Srgap3 UTSW 6 112771378 missense probably damaging 0.99
R8067:Srgap3 UTSW 6 112739364 missense probably benign 0.00
X0062:Srgap3 UTSW 6 112795786 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCCAGTCCTGACTTCC -3'
(R):5'- TAGCAAAACTGGGGCTCTGG -3'

Sequencing Primer
(F):5'- GGCCTCCTTCGCCAATTG -3'
(R):5'- GCTCTGGCTGGGCTCTG -3'
Posted On2018-08-29