Incidental Mutation 'R6797:Mrgprb8'
ID533050
Institutional Source Beutler Lab
Gene Symbol Mrgprb8
Ensembl Gene ENSMUSG00000050870
Gene NameMAS-related GPR, member B8
SynonymsMrgB8
MMRRC Submission
Accession Numbers

Genbank: NM_207539;  MGI: 3033134

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location48388526-48389648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48389144 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 188 (V188I)
Ref Sequence ENSEMBL: ENSMUSP00000052230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056676]
Predicted Effect probably benign
Transcript: ENSMUST00000056676
AA Change: V188I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000052230
Gene: ENSMUSG00000050870
AA Change: V188I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 37 219 3.9e-7 PFAM
low complexity region 302 327 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Mrgprb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02031:Mrgprb8 APN 7 48389339 missense probably benign 0.01
IGL02191:Mrgprb8 APN 7 48388779 missense probably damaging 1.00
IGL02449:Mrgprb8 APN 7 48388683 nonsense probably null
IGL02724:Mrgprb8 APN 7 48389373 missense possibly damaging 0.85
IGL02927:Mrgprb8 APN 7 48388625 nonsense probably null
astroclast1 UTSW 7 48389144 missense probably benign 0.05
A4554:Mrgprb8 UTSW 7 48389408 missense probably damaging 1.00
R0676:Mrgprb8 UTSW 7 48388664 missense probably benign
R0890:Mrgprb8 UTSW 7 48389029 nonsense probably null
R2094:Mrgprb8 UTSW 7 48389205 missense probably benign 0.16
R2102:Mrgprb8 UTSW 7 48388886 missense possibly damaging 0.56
R4839:Mrgprb8 UTSW 7 48388908 missense probably benign 0.18
R5370:Mrgprb8 UTSW 7 48388820 missense probably benign 0.00
R5471:Mrgprb8 UTSW 7 48388723 missense probably damaging 1.00
R5548:Mrgprb8 UTSW 7 48389030 missense probably benign 0.29
R6165:Mrgprb8 UTSW 7 48388817 missense possibly damaging 0.78
R6199:Mrgprb8 UTSW 7 48389303 missense probably benign 0.00
R6315:Mrgprb8 UTSW 7 48389235 missense probably damaging 1.00
R6924:Mrgprb8 UTSW 7 48389123 missense possibly damaging 0.71
R8219:Mrgprb8 UTSW 7 48388901 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCCTCTTCCTCTGCACTCACATT -3'
(R):5'- AGCAAATGATAGGATTGGCACAG -3'

Sequencing Primer
(F):5'- CCCTGGAAAATCTCATTAGG -3'
(R):5'- CAGCTGTTAACACCGGATAG -3'
Posted On2018-08-29