Incidental Mutation 'R6797:Jaml'
ID533056
Institutional Source Beutler Lab
Gene Symbol Jaml
Ensembl Gene ENSMUSG00000048534
Gene Namejunction adhesion molecule like
SynonymsLOC270152, Amica1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location45079183-45108534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45088760 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 77 (C77R)
Ref Sequence ENSEMBL: ENSMUSP00000150449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050020] [ENSMUST00000215880] [ENSMUST00000216426]
Predicted Effect probably damaging
Transcript: ENSMUST00000050020
AA Change: C119R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052033
Gene: ENSMUSG00000048534
AA Change: C119R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 30 139 5.7e-8 SMART
IG 143 254 9.26e-8 SMART
low complexity region 293 304 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215880
AA Change: C119R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216426
AA Change: C77R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Jaml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Jaml APN 9 45100989 unclassified probably benign
IGL00771:Jaml APN 9 45093807 missense possibly damaging 0.94
IGL01139:Jaml APN 9 45101019 missense possibly damaging 0.91
IGL02669:Jaml APN 9 45104191 missense possibly damaging 0.68
IGL03405:Jaml APN 9 45093809 missense possibly damaging 0.61
R0207:Jaml UTSW 9 45093767 missense probably benign 0.01
R1962:Jaml UTSW 9 45104197 missense possibly damaging 0.80
R2119:Jaml UTSW 9 45101064 missense probably damaging 1.00
R2120:Jaml UTSW 9 45101064 missense probably damaging 1.00
R2124:Jaml UTSW 9 45101064 missense probably damaging 1.00
R2358:Jaml UTSW 9 45101063 missense possibly damaging 0.95
R3917:Jaml UTSW 9 45101151 unclassified probably benign
R4801:Jaml UTSW 9 45101064 missense possibly damaging 0.57
R4802:Jaml UTSW 9 45101064 missense possibly damaging 0.57
R5224:Jaml UTSW 9 45104266 missense probably damaging 1.00
R5739:Jaml UTSW 9 45088728 missense probably damaging 1.00
R5760:Jaml UTSW 9 45097754 missense probably benign 0.02
R6033:Jaml UTSW 9 45088710 missense probably damaging 1.00
R6033:Jaml UTSW 9 45088710 missense probably damaging 1.00
R6174:Jaml UTSW 9 45088773 missense probably damaging 1.00
R6245:Jaml UTSW 9 45097919 missense probably damaging 1.00
R6753:Jaml UTSW 9 45107379 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CCAGAGTCCTAGGTCTTGTTCC -3'
(R):5'- TGAAGACTCGCCCTAAGGTG -3'

Sequencing Primer
(F):5'- GAGTCCTAGGTCTTGTTCCCTTCTTG -3'
(R):5'- GCCCTAAGGTGAGTACTTAGC -3'
Posted On2018-08-29