Incidental Mutation 'R6797:Casp14'
ID533057
Institutional Source Beutler Lab
Gene Symbol Casp14
Ensembl Gene ENSMUSG00000005355
Gene Namecaspase 14
Synonymsmini-ICE, MICE
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78711991-78718294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78715141 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 70 (D70G)
Ref Sequence ENSEMBL: ENSMUSP00000151657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005488] [ENSMUST00000219237]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005488
AA Change: D70G

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000005488
Gene: ENSMUSG00000005355
AA Change: D70G

DomainStartEndE-ValueType
CASc 15 257 1.42e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000219237
AA Change: D70G

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This caspase has been shown to be processed and activated by caspase 8 and caspase 10 in vitro, and by anti-Fas agonist antibody or TNF-related apoptosis inducing ligand in vivo. The expression and processing of this caspase may be involved in keratinocyte terminal differentiation, which is important for the formation of the skin barrier. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired skin barrier function, skin dehydration and increased damage in response to UVB irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Casp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Casp14 APN 10 78715403 missense probably damaging 1.00
IGL03205:Casp14 APN 10 78713339 makesense probably null
R2082:Casp14 UTSW 10 78715033 missense probably benign 0.01
R4717:Casp14 UTSW 10 78715124 missense probably benign 0.38
R4840:Casp14 UTSW 10 78713344 nonsense probably null
R5174:Casp14 UTSW 10 78715391 missense possibly damaging 0.58
R5591:Casp14 UTSW 10 78714345 missense unknown
R7477:Casp14 UTSW 10 78714304 missense probably benign 0.00
R8063:Casp14 UTSW 10 78714031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGATGTCCCAGTCCCTAC -3'
(R):5'- GCATGTTCCGTTACCTGAAATTTG -3'

Sequencing Primer
(F):5'- CAAGCCTGGATGATGTACACCTTTG -3'
(R):5'- TCCGTTACCTGAAATTTGAAAGCACC -3'
Posted On2018-08-29