Incidental Mutation 'R6797:Stc2'
ID533058
Institutional Source Beutler Lab
Gene Symbol Stc2
Ensembl Gene ENSMUSG00000020303
Gene Namestanniocalcin 2
SynonymsStc2l, mustc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location31357307-31370074 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 31365351 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 163 (K163*)
Ref Sequence ENSEMBL: ENSMUSP00000020546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020546]
Predicted Effect probably null
Transcript: ENSMUST00000020546
AA Change: K163*
SMART Domains Protein: ENSMUSP00000020546
Gene: ENSMUSG00000020303
AA Change: K163*

DomainStartEndE-ValueType
Pfam:Stanniocalcin 12 215 1.4e-94 PFAM
low complexity region 271 282 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are 10-15% larger and grow at a faster rate than wild-type controls from 4 weeks onward. The increased body weight results from an increase in the weight of most major organs, with the exception of testis. Mean alkaline phosphatase levels are 144% of wild-type levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Stc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Stc2 APN 11 31367875 splice site probably benign
IGL03330:Stc2 APN 11 31369804 missense probably benign 0.01
R0016:Stc2 UTSW 11 31360177 missense probably benign 0.00
R0016:Stc2 UTSW 11 31360177 missense probably benign 0.00
R0025:Stc2 UTSW 11 31365559 splice site probably null
R1510:Stc2 UTSW 11 31365418 nonsense probably null
R4581:Stc2 UTSW 11 31365326 splice site probably null
R6106:Stc2 UTSW 11 31360392 missense probably benign
R6252:Stc2 UTSW 11 31360346 missense probably damaging 0.98
R6675:Stc2 UTSW 11 31360307 missense probably benign
R7192:Stc2 UTSW 11 31369872 start gained probably benign
R7545:Stc2 UTSW 11 31367799 missense probably damaging 1.00
R7570:Stc2 UTSW 11 31367798 missense probably damaging 1.00
R7846:Stc2 UTSW 11 31365413 missense probably benign 0.13
R8057:Stc2 UTSW 11 31367806 nonsense probably null
R8273:Stc2 UTSW 11 31369777 missense possibly damaging 0.80
Z1176:Stc2 UTSW 11 31360415 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AACCAGTTGGGACTTGGCTAG -3'
(R):5'- TTCATCAAGGATGCCCTGAG -3'

Sequencing Primer
(F):5'- CAAATCTGATGATCTTCTGGGGG -3'
(R):5'- TGAGGTGCAAGGCCCATG -3'
Posted On2018-08-29