Incidental Mutation 'R6797:Hist1h2bk'
ID533063
Institutional Source Beutler Lab
Gene Symbol Hist1h2bk
Ensembl Gene ENSMUSG00000062727
Gene Namehistone cluster 1, H2bk
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6797 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location22035870-22036345 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22036089 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 68 (N68I)
Ref Sequence ENSEMBL: ENSMUSP00000106085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091742] [ENSMUST00000102977] [ENSMUST00000110455]
Predicted Effect probably benign
Transcript: ENSMUST00000091742
SMART Domains Protein: ENSMUSP00000089336
Gene: ENSMUSG00000069302

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102977
SMART Domains Protein: ENSMUSP00000100042
Gene: ENSMUSG00000060639

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110455
AA Change: N68I

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106085
Gene: ENSMUSG00000062727
AA Change: N68I

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Hist1h2bk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03331:Hist1h2bk APN 13 22036273 utr 3 prime probably benign
R0924:Hist1h2bk UTSW 13 22036040 missense probably damaging 0.98
R6631:Hist1h2bk UTSW 13 22036221 missense probably damaging 0.96
R7884:Hist1h2bk UTSW 13 22036055 missense probably damaging 1.00
R7967:Hist1h2bk UTSW 13 22036055 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCTACGCCATGCCTGAG -3'
(R):5'- ATTGAGAAGTTTACTTGGCGC -3'

Sequencing Primer
(F):5'- ATGCCTGAGCCTGCGAAGTC -3'
(R):5'- CGCTAGTATACTTGGTGACAGCC -3'
Posted On2018-08-29