Incidental Mutation 'R6797:Serpinb9b'
ID533064
Institutional Source Beutler Lab
Gene Symbol Serpinb9b
Ensembl Gene ENSMUSG00000021403
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9b
Synonyms1600019A21Rik, Spi10, ovalbumin, SPI-CI, R86
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location33027416-33041884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33029484 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 8 (N8S)
Ref Sequence ENSEMBL: ENSMUSP00000006392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006392]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006392
AA Change: N8S

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000006392
Gene: ENSMUSG00000021403
AA Change: N8S

DomainStartEndE-ValueType
SERPIN 13 377 7.86e-164 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Serpinb9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Serpinb9b APN 13 33035625 missense probably benign 0.00
IGL00518:Serpinb9b APN 13 33039570 missense probably benign 0.17
IGL01939:Serpinb9b APN 13 33039665 missense probably damaging 0.99
IGL02472:Serpinb9b APN 13 33039970 utr 3 prime probably benign
IGL02632:Serpinb9b APN 13 33039823 missense probably benign 0.01
R0255:Serpinb9b UTSW 13 33038020 missense probably benign
R0667:Serpinb9b UTSW 13 33032926 nonsense probably null
R0699:Serpinb9b UTSW 13 33033566 missense probably benign 0.00
R0703:Serpinb9b UTSW 13 33032981 missense probably benign 0.29
R1605:Serpinb9b UTSW 13 33038129 critical splice donor site probably null
R1623:Serpinb9b UTSW 13 33029565 missense possibly damaging 0.61
R1815:Serpinb9b UTSW 13 33039904 missense probably damaging 1.00
R1920:Serpinb9b UTSW 13 33039548 critical splice acceptor site probably null
R1987:Serpinb9b UTSW 13 33029559 missense probably benign 0.07
R1988:Serpinb9b UTSW 13 33029559 missense probably benign 0.07
R3035:Serpinb9b UTSW 13 33029546 missense possibly damaging 0.81
R3683:Serpinb9b UTSW 13 33029598 missense probably damaging 0.98
R3758:Serpinb9b UTSW 13 33035588 missense probably damaging 1.00
R4677:Serpinb9b UTSW 13 33039823 missense probably damaging 0.97
R5412:Serpinb9b UTSW 13 33029513 missense probably benign 0.00
R5481:Serpinb9b UTSW 13 33038093 missense possibly damaging 0.93
R5672:Serpinb9b UTSW 13 33039599 missense probably benign 0.01
R5957:Serpinb9b UTSW 13 33039848 missense possibly damaging 0.81
R7586:Serpinb9b UTSW 13 33039760 missense probably damaging 1.00
R8115:Serpinb9b UTSW 13 33035548 missense probably null 0.94
R8309:Serpinb9b UTSW 13 33039571 missense probably damaging 1.00
X0019:Serpinb9b UTSW 13 33035531 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGTAGTATGGTCTGCTGC -3'
(R):5'- ATGCATGTGACATGGGTAGG -3'

Sequencing Primer
(F):5'- TATGGTCTGCTGCCATGGCC -3'
(R):5'- TAGGGTTATGACAGAGAACATACCTG -3'
Posted On2018-08-29