Mutagenetix > Incidental Mutations

Incidental Mutation 'R6797:Hk3'

533067

Institutional Source

Beutler Lab

Gene Symbol

Hk3

Ensembl Gene

ENSMUSG00000025877

Gene Name

hexokinase 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R6797 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55005985-55021385 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 55010831 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000115227 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026994] [ENSMUST00000052949] [ENSMUST00000109994] [ENSMUST00000123097] [ENSMUST00000126234] [ENSMUST00000132309] [ENSMUST00000148221] [ENSMUST00000153665]

Predicted Effect

probably benign
Transcript: ENSMUST00000026994

SMART Domains

Protein: ENSMUSP00000026994
Gene: ENSMUSG00000025876

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
SCOP:d1biha1	44	143	1e-4	SMART
IG	155	240	1.8e-5	SMART
TSP1	245	296	1.25e-14	SMART
TSP1	301	350	1.98e-8	SMART
transmembrane domain	360	382	N/A	INTRINSIC
ZU5	495	598	3.68e-58	SMART
DEATH	805	896	5.86e-20	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000052949

SMART Domains

Protein: ENSMUSP00000051215
Gene: ENSMUSG00000025877

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	29	232	3.7e-76	PFAM
Pfam:Hexokinase_2	234	473	1.9e-87	PFAM
Pfam:Hexokinase_1	475	674	2.2e-77	PFAM
Pfam:Hexokinase_2	676	915	2.3e-103	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109994

SMART Domains

Protein: ENSMUSP00000105621
Gene: ENSMUSG00000025876

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
SCOP:d1biha1	44	143	1e-4	SMART
IG	155	240	1.8e-5	SMART
TSP1	245	294	1.98e-8	SMART
transmembrane domain	305	327	N/A	INTRINSIC
ZU5	439	542	3.68e-58	SMART
DEATH	749	840	5.86e-20	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000123097

SMART Domains

Protein: ENSMUSP00000116717
Gene: ENSMUSG00000025877

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	29	232	3.3e-77	PFAM
Pfam:Hexokinase_2	234	457	6e-74	PFAM
Pfam:Hexokinase_1	430	629	3e-78	PFAM
Pfam:Hexokinase_2	631	870	1e-104	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000126234

SMART Domains

Protein: ENSMUSP00000123233
Gene: ENSMUSG00000025877

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	31	230	2.4e-63	PFAM
Pfam:Hexokinase_2	236	470	2.9e-62	PFAM
Pfam:Hexokinase_1	480	673	2e-69	PFAM
Pfam:Hexokinase_2	678	912	1.5e-81	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132309

SMART Domains

Protein: ENSMUSP00000117254
Gene: ENSMUSG00000025877

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	29	164	4.1e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148221

Predicted Effect

probably null
Transcript: ENSMUST00000153665

SMART Domains

Protein: ENSMUSP00000115227
Gene: ENSMUSG00000025877

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	1	177	8.5e-70	PFAM
Pfam:Hexokinase_2	179	418	9.4e-88	PFAM
Pfam:Hexokinase_1	420	619	1.2e-77	PFAM
Pfam:Hexokinase_2	621	860	1.1e-103	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 96.8%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 3. Similar to hexokinases 1 and 2, this allosteric enzyme is inhibited by its product glucose-6-phosphate. [provided by RefSeq, Apr 2009]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c18	T	A	13: 4,145,277	I61L	probably benign	Het
Angptl2	T	C	2: 33,228,265	V17A	probably benign	Het
Casp14	T	C	10: 78,715,141	D70G	possibly damaging	Het
Cckbr	A	G	7: 105,434,566	M234V	possibly damaging	Het
Cd93	T	C	2: 148,442,124	N434S	probably benign	Het
Cenpe	A	T	3: 135,238,138	Q938L	possibly damaging	Het
Col6a3	A	C	1: 90,804,088	V1481G	probably damaging	Het
Dnah5	G	T	15: 28,233,238	E248*	probably null	Het
Dnah5	G	A	15: 28,451,463	R4349Q	probably damaging	Het
F11	A	G	8: 45,253,055	Y98H	probably benign	Het
Fam208b	T	C	13: 3,576,769	I1060M	probably benign	Het
Fen1	A	G	19: 10,200,703	F126L	probably benign	Het
Gpr146	G	A	5: 139,393,040	G199D	possibly damaging	Het
Gramd1b	A	G	9: 40,308,406	I324T	probably benign	Het
Hist1h2bk	A	T	13: 22,036,089	N68I	probably benign	Het
Hivep1	C	A	13: 42,157,081	S932R	probably benign	Het
Hspbp1	T	A	7: 4,660,782	M355L	possibly damaging	Het
Jaml	T	C	9: 45,088,760	C77R	probably damaging	Het
Kmt2e	A	G	5: 23,482,507	N452D	possibly damaging	Het
Krt5	T	C	15: 101,712,641	Y57C	unknown	Het
Lipn	A	T	19: 34,080,760	M294L	probably benign	Het
Magel2	A	G	7: 62,380,159	E937G	unknown	Het
Med13l	G	A	5: 118,759,264		probably null	Het
Mrgprb8	G	A	7: 48,389,144	V188I	probably benign	Het
Ocln	T	C	13: 100,539,715	D90G	probably damaging	Het
Ofcc1	C	T	13: 40,087,947	R695Q	possibly damaging	Het
Olfr598	G	A	7: 103,329,121	V212I	probably benign	Het
Olfr748	T	A	14: 50,711,106	Y259N	probably damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Pak7	A	T	2: 136,097,534	H560Q	probably damaging	Het
Pigg	T	C	5: 108,332,828	S493P	probably damaging	Het
Ppp6r3	A	G	19: 3,514,719	W185R	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Sacs	T	A	14: 61,213,073	D4189E	probably damaging	Het
Serpinb9b	A	G	13: 33,029,484	N8S	possibly damaging	Het
Slit3	A	G	11: 35,633,952	T730A	possibly damaging	Het
Srgap3	A	T	6: 112,829,542	F53I	probably damaging	Het
Stc2	T	A	11: 31,365,351	K163*	probably null	Het
Tlk1	T	A	2: 70,738,426	K411*	probably null	Het
Ttc27	G	T	17: 74,729,888	L185F	probably benign	Het
Vmn2r102	C	T	17: 19,660,432	Q12*	probably null	Het
Vmn2r95	C	T	17: 18,452,289		probably benign	Het
Vopp1	A	G	6: 57,762,507	Y19H	possibly damaging	Het
Wdr64	T	A	1: 175,810,610		probably null	Het

Other mutations in Hk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00941:Hk3	APN	13	55014426	critical splice donor site	probably null
IGL01314:Hk3	APN	13	55007063	splice site	probably benign
IGL02043:Hk3	APN	13	55015095	missense	probably damaging	1.00
IGL02197:Hk3	APN	13	55014468	missense	probably damaging	1.00
IGL02619:Hk3	APN	13	55014294	missense	probably damaging	1.00
R0454:Hk3	UTSW	13	55008705	missense	probably damaging	1.00
R0518:Hk3	UTSW	13	55014426	critical splice donor site	probably null
R0521:Hk3	UTSW	13	55014426	critical splice donor site	probably null
R0709:Hk3	UTSW	13	55014730	missense	probably damaging	1.00
R1386:Hk3	UTSW	13	55007030	intron	probably null
R1567:Hk3	UTSW	13	55006605	missense	probably damaging	1.00
R1647:Hk3	UTSW	13	55014461	missense	probably damaging	1.00
R1648:Hk3	UTSW	13	55014461	missense	probably damaging	1.00
R1663:Hk3	UTSW	13	55006575	missense	probably benign	0.00
R1936:Hk3	UTSW	13	55011391	missense	probably damaging	0.98
R1940:Hk3	UTSW	13	55011391	missense	probably damaging	0.98
R1966:Hk3	UTSW	13	55014455	missense	probably damaging	1.00
R2345:Hk3	UTSW	13	55008993	missense	probably damaging	1.00
R4838:Hk3	UTSW	13	55006418	missense	probably damaging	1.00
R4852:Hk3	UTSW	13	55012596	missense	probably damaging	0.99
R4883:Hk3	UTSW	13	55010922	missense	probably benign	0.04
R4888:Hk3	UTSW	13	55006592	missense	probably damaging	1.00
R5100:Hk3	UTSW	13	55009030	missense	probably damaging	1.00
R5253:Hk3	UTSW	13	55011011	missense	probably damaging	1.00
R5328:Hk3	UTSW	13	55013493	missense	probably benign	0.00
R5441:Hk3	UTSW	13	55015056	missense	probably damaging	1.00
R5493:Hk3	UTSW	13	55011171	missense	probably damaging	1.00
R5557:Hk3	UTSW	13	55012075	nonsense	probably null
R5575:Hk3	UTSW	13	55014770	missense	probably damaging	0.99
R5578:Hk3	UTSW	13	55012181	missense	probably damaging	1.00
R5686:Hk3	UTSW	13	55006813	missense	probably damaging	1.00
R5872:Hk3	UTSW	13	55010804	missense	probably damaging	1.00
R6038:Hk3	UTSW	13	55006560	missense	probably benign	0.13
R6038:Hk3	UTSW	13	55006560	missense	probably benign	0.13
R6314:Hk3	UTSW	13	55013580	missense	probably benign	0.02
R6315:Hk3	UTSW	13	55011157	missense	probably benign	0.03
R6827:Hk3	UTSW	13	55011352	missense	probably damaging	0.98
R6860:Hk3	UTSW	13	55014465	missense	probably damaging	0.98
R7082:Hk3	UTSW	13	55006897	missense	probably benign	0.40
R7227:Hk3	UTSW	13	55012240	missense	probably benign	0.00
R7564:Hk3	UTSW	13	55011396	missense	probably damaging	1.00
X0003:Hk3	UTSW	13	55007136	missense	probably benign	0.01
Z1177:Hk3	UTSW	13	55010708	missense	probably damaging	1.00
Z1177:Hk3	UTSW	13	55010710	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CTTAAAGGGCACATGGATCGG -3'
(R):5'- ACAGAGCGAGGTGATTTCCTG -3'

Sequencing Primer
(F):5'- ACATGGATCGGAGGCCCTG -3'
(R):5'- GATTTCCTGGCCTTGGACCTAG -3'

Posted On

2018-08-29